CRISPR

CRISPR5-myo7aa

ID
ZDB-CRISPR-250203-5
Name
CRISPR5-myo7aa
Previous Names
None
Target
Sequence
5' - GTATACGGGGTCCATCTTAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hn13 myo7aa
hn14 myo7aa
Expression
Gene expression in Wild Types + CRISPR5-myo7aa
No data available
Phenotype
Phenotype resulting from CRISPR5-myo7aa
No data available
Phenotype of all Fish created by or utilizing CRISPR5-myo7aa
Phenotype Fish Conditions Figures
whole organism kif5bb expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Xie et al., 2024
whole organism pmaip1 expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
whole organism kif5bb expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
whole organism dab2ipa expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
inner ear hair cell absence of anatomical entity, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 3 with image,  Fig. 6 with image,  Fig. 7 with image from Xie et al., 2024
inner ear hair cell amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
startle response decreased process quality, abnormal myo7aahn13/hn13 (TU) vibration, chemical treatment by environment: ATP Fig. 6 with image from Xie et al., 2024
whole organism arhgef40 expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism arhgef40 expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image from Xie et al., 2024
auditory behavior process quality, ameliorated myo7aahn13/hn13 (TU) vibration, chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism kif5bb expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
auditory behavior decreased process quality, abnormal myo7aahn13/hn13 (TU) vibration, chemical treatment by environment: ATP Fig. 6 with image from Xie et al., 2024
whole organism grk3 expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism rab11fip3 expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism dab2ipb expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism mapk8ip2 expression increased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism agap3 expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism dab2ipa expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image from Xie et al., 2024
whole organism rab11fip3 expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
startle response decreased process quality, abnormal myo7aahn13/hn13 (TU) vibration Fig. 3 with image,  Fig. 6 with image from Xie et al., 2024
whole organism grk3 expression amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
startle response process quality, ameliorated myo7aahn13/hn13 (TU) vibration, chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism mapk8b expression increased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism fosb expression increased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
auditory behavior decreased process quality, abnormal myo7aahn13/hn13 (TU) vibration Fig. 3 with image,  Fig. 6 with image from Xie et al., 2024
whole organism pmaip1 expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image,  Fig. 7 with image from Xie et al., 2024
whole organism grk3 expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Xie et al., 2024
whole organism rab11fip3 expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Xie et al., 2024
whole organism arhgap33 expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism ehd3 expression decreased amount, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
lateral line hair cell absence of anatomical entity, abnormal myo7aahn13/hn13 (TU) standard conditions Fig. 3 with image from Xie et al., 2024
inner ear hair cell amount, ameliorated myo7aahn13/hn13 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism pmaip1 expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
startle response decreased process quality, abnormal myo7aahn14/hn14 (TU) vibration, chemical treatment by environment: ATP Fig. 6 with image from Xie et al., 2024
whole organism dab2ipa expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
inner ear hair cell absence of anatomical entity, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 3 with image,  Fig. 6 with image,  Fig. 7 with image from Xie et al., 2024
whole organism kif5bb expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
whole organism kif5bb expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Xie et al., 2024
inner ear hair cell amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
whole organism arhgef40 expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image from Xie et al., 2024
whole organism arhgef40 expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
auditory behavior process quality, ameliorated myo7aahn14/hn14 (TU) vibration, chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism kif5bb expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
auditory behavior decreased process quality, abnormal myo7aahn14/hn14 (TU) vibration, chemical treatment by environment: ATP Fig. 6 with image from Xie et al., 2024
whole organism grk3 expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism rab11fip3 expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism dab2ipb expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism mapk8ip2 expression increased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism agap3 expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism dab2ipa expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image from Xie et al., 2024
whole organism grk3 expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
whole organism rab11fip3 expression amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: ATP Fig. 7 with image from Xie et al., 2024
startle response decreased process quality, abnormal myo7aahn14/hn14 (TU) vibration Fig. 3 with image,  Fig. 6 with image from Xie et al., 2024
startle response process quality, ameliorated myo7aahn14/hn14 (TU) vibration, chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism fosb expression increased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
auditory behavior decreased process quality, abnormal myo7aahn14/hn14 (TU) vibration Fig. 3 with image,  Fig. 6 with image from Xie et al., 2024
whole organism mapk8b expression increased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
whole organism grk3 expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Xie et al., 2024
whole organism pmaip1 expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image,  Fig. 7 with image from Xie et al., 2024
whole organism rab11fip3 expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 7 with image from Xie et al., 2024
inner ear hair cell amount, ameliorated myo7aahn14/hn14 (TU) chemical treatment by environment: GTP Fig. 6 with image from Xie et al., 2024
whole organism arhgap33 expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
lateral line hair cell absence of anatomical entity, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 3 with image from Xie et al., 2024
whole organism ehd3 expression decreased amount, abnormal myo7aahn14/hn14 (TU) standard conditions Fig. 5 with image from Xie et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.