CRISPR

CRISPR6-egr3

ID
ZDB-CRISPR-241231-3
Name
CRISPR6-egr3
Previous Names
None
Target
Sequence
5' - GGCAAGGATGAGGACGTGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 8
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns576Pt egr3
bns577 egr3
Expression
Gene expression in Wild Types + CRISPR6-egr3
No data available
Phenotype
Phenotype resulting from CRISPR6-egr3
No data available
Phenotype of all Fish created by or utilizing CRISPR6-egr3
Phenotype Fish Conditions Figures
atrioventricular canal endocardium spp1 expression decreased amount, abnormal egr3bns577/bns577 standard conditions Fig. 3. with image from da Silva et al., 2024
atrioventricular canal endocardium nr4a2b expression decreased amount, abnormal egr3bns577/bns577 standard conditions Fig. 3. with image from da Silva et al., 2024
atrioventricular canal endocardium EGFP expression increased distribution, abnormal egr3bns576Pt/+; bns193Tg; nkuasgfp1aTg; s896Tg mechanical stress Fig. 5. with image from da Silva et al., 2024
atrioventricular canal endothelial cell migration decreased process quality, abnormal egr3bns577/+; egr3bns576Pt/+; is4Tg; nkuasgfp1aTg standard conditions Fig. 3. with image from da Silva et al., 2024
atrioventricular valve formation decreased process quality, abnormal egr3bns577/+; egr3bns576Pt/+; is4Tg; nkuasgfp1aTg standard conditions Fig. 3. with image from da Silva et al., 2024
atrioventricular canal endothelial cell migration decreased process quality, abnormal egr3bns577/+; egr3bns576Pt/+; rk8Tg standard conditions Fig. 4. with image from da Silva et al., 2024
atrioventricular valve formation decreased process quality, abnormal egr3bns577/+; egr3bns576Pt/+; rk8Tg standard conditions Fig. 4. with image from da Silva et al., 2024
heart lacks all parts of type atrioventricular valve, abnormal egr3bns577/+; egr3bns661Tg/+; bns193Tg; s896Tg; s898Tg standard conditions Fig. 2. with image from da Silva et al., 2024
atrioventricular valve formation decreased process quality, abnormal egr3bns577/+; egr3bns661Tg/+; bns193Tg; s896Tg; s898Tg standard conditions Fig. 2. with image from da Silva et al., 2024
ventriculo bulbo valve formation decreased process quality, abnormal egr3bns577/bns577; bns193Tg; s843Tg standard conditions Fig. 1. with image from da Silva et al., 2024
heart lacks all parts of type atrioventricular valve, abnormal egr3bns577/bns577; bns193Tg; s843Tg standard conditions Fig. 1. with image from da Silva et al., 2024
atrioventricular valve formation decreased process quality, abnormal egr3bns577/bns577; bns193Tg; s843Tg standard conditions Fig. 1. with image from da Silva et al., 2024
heart lacks all parts of type ventriculo bulbo valve, abnormal egr3bns577/bns577; bns193Tg; s843Tg standard conditions Fig. 1. with image from da Silva et al., 2024
heart edematous, abnormal egr3bns577/bns577; bns193Tg; s843Tg standard conditions Fig. 1. with image from da Silva et al., 2024
atrioventricular canal endothelial cell migration process quality, ameliorated egr3bns577/+; egr3bns576Pt/+; bns719Tg; rk8Tg standard conditions Fig. 4. with image from da Silva et al., 2024
atrioventricular valve formation process quality, ameliorated egr3bns577/+; egr3bns576Pt/+; bns719Tg; rk8Tg standard conditions Fig. 4. with image from da Silva et al., 2024
Citations