CRISPR

CRISPR3-nomo

ID
ZDB-CRISPR-241030-2
Name
CRISPR3-nomo
Previous Names
None
Target
Sequence
5' - GGGCTATGATGTCTCTGGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3952 nomo
Expression
Gene expression in Wild Types + CRISPR3-nomo
No data available
Phenotype
Phenotype resulting from CRISPR3-nomo
No data available
Phenotype of all Fish created by or utilizing CRISPR3-nomo
Phenotype Fish Conditions Figures
brain il1b expression increased amount, abnormal nomozf3952/zf3952 standard conditions Figure 6 with image from Zhang et al., 2024
brain bcl2a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Figure 5 with image from Zhang et al., 2024
brain bbc3 expression increased amount, abnormal nomozf3952/zf3952 standard conditions Figure 5 with image from Zhang et al., 2024
brain gad1b expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
developmental growth delayed, abnormal nomozf3952/zf3952 standard conditions Fig. EV2 from Zhang et al., 2024
brain elavl3 expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
swimming behavior process quality, ameliorated nomozf3952/zf3952 chemical treatment by environment: minocycline Figure 6 with image from Zhang et al., 2024
social behavior decreased process quality, abnormal nomozf3952/zf3952 standard conditions Figure 4 with image,  Figure 6 with image,  Figure 7 with image from Zhang et al., 2024
brain serotonin increased amount, abnormal nomozf3952/zf3952 standard conditions Figure 7 with image from Zhang et al., 2024
brain L-dopa increased amount, abnormal nomozf3952/zf3952 standard conditions Figure 7 with image from Zhang et al., 2024
locomotory behavior decreased process quality, abnormal nomozf3952/zf3952 altered light dark cycle Figure 2 with image from Zhang et al., 2024
social behavior decreased process quality, exacerbated nomozf3952/zf3952 chemical treatment by environment: 4-chloro-L-phenylalanine Fig. EV4 from Zhang et al., 2024
midbrain neurog1 expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3 from Zhang et al., 2024
brain inflammatory response increased frequency, abnormal nomozf3952/zf3952 standard conditions Figure 6 with image from Zhang et al., 2024
yolk malformed, abnormal nomozf3952/zf3952 standard conditions Fig. EV2 from Zhang et al., 2024
brain melatonin increased amount, abnormal nomozf3952/zf3952 standard conditions Figure 7 with image from Zhang et al., 2024
neuron decreased ratio forebrain, abnormal nomozf3952/zf3952 standard conditions Figure 1 with image from Zhang et al., 2024
brain egr2b expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
locomotory behavior decreased process quality, abnormal nomozf3952/zf3952 chemical treatment by environment: minocycline Figure 6 with image from Zhang et al., 2024
neuroectoderm foxb1a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3 from Zhang et al., 2024
brain sim1a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
brain il6 expression increased amount, abnormal nomozf3952/zf3952 standard conditions Figure 6 with image from Zhang et al., 2024
social behavior decreased process quality, abnormal nomozf3952/zf3952 chemical treatment by environment: melatonin Figure 7 with image from Zhang et al., 2024
head nomo expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Figure 1 with image from Zhang et al., 2024
pericardium edematous, abnormal nomozf3952/zf3952 standard conditions Fig. EV2 from Zhang et al., 2024
neuron decreased ratio telencephalon, abnormal nomozf3952/zf3952 standard conditions Figure 1 with image from Zhang et al., 2024
brain pidd1 expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Figure 5 with image from Zhang et al., 2024
hindbrain foxb1a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3 from Zhang et al., 2024
brain th expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3 from Zhang et al., 2024
locomotory behavior increased rate, abnormal nomozf3952/zf3952 standard conditions Figure 6 with image from Zhang et al., 2024
locomotory behavior increased rate, abnormal nomozf3952/zf3952 chemical treatment by environment: minocycline Figure 6 with image from Zhang et al., 2024
brain neurog1 expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
whole organism nomo expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Figure 1 with image from Zhang et al., 2024
locomotory behavior process quality, ameliorated nomozf3952/zf3952 chemical treatment by environment: 4-chloro-L-phenylalanine Fig. EV4 from Zhang et al., 2024
hindbrain isl1a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3 from Zhang et al., 2024
social behavior decreased process quality, abnormal nomozf3952/zf3952 chemical treatment by environment: minocycline Figure 6 with image from Zhang et al., 2024
brain fezf2 expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
brain decreased mass, abnormal nomozf3952/zf3952 standard conditions Figure 1 with image from Zhang et al., 2024
brain dlx2a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
brain il6 expression increased amount, abnormal nomozf3952/zf3952 chemical treatment by environment: minocycline Figure 6 with image from Zhang et al., 2024
brain isl1a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
hindbrain neurog1 expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3 from Zhang et al., 2024
locomotory behavior process quality, ameliorated nomozf3952/zf3952 chemical treatment by environment: melatonin Figure 7 with image from Zhang et al., 2024
habenula neuron decreased amount, abnormal nomozf3952/zf3952 standard conditions Figure 1 with image from Zhang et al., 2024
larval locomotory behavior increased rate, abnormal nomozf3952/zf3952 standard conditions Figure 3 with image from Zhang et al., 2024
midbrain foxb1a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3 from Zhang et al., 2024
midbrain isl1a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3 from Zhang et al., 2024
epiphysis neuron decreased amount, abnormal nomozf3952/zf3952 standard conditions Figure 1 with image from Zhang et al., 2024
locomotory behavior decreased process quality, abnormal nomozf3952/zf3952 standard conditions Figure 3 with image,  Figure 6 with image,  Figure 7 with image from Zhang et al., 2024
brain bcl2l1 expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Figure 5 with image from Zhang et al., 2024
brain il1b expression amount, ameliorated nomozf3952/zf3952 chemical treatment by environment: minocycline Figure 6 with image from Zhang et al., 2024
caudal fin bent, abnormal nomozf3952/zf3952 standard conditions Fig. EV2 from Zhang et al., 2024
brain apoptotic process increased frequency, abnormal nomozf3952/zf3952 standard conditions Figure 6 with image from Zhang et al., 2024
swimming behavior decreased process quality, abnormal nomozf3952/zf3952 standard conditions Figure 6 with image from Zhang et al., 2024
brain foxb1a expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Fig. EV3,  Figure 5 with image from Zhang et al., 2024
brain nomo expression decreased amount, abnormal nomozf3952/zf3952 standard conditions Figure 1 with image from Zhang et al., 2024
neuronal stem cell RFP expression decreased amount, abnormal nomozf3952/zf3952; fdu101Tg/fdu101Tg standard conditions Figure 5 with image from Zhang et al., 2024
hindbrain GABAergic neuron EGFP expression decreased amount, abnormal nomozf3952/zf3952; ion84Tg/ion84Tg standard conditions Figure 5 with image from Zhang et al., 2024
spinal cord GABAergic neuron EGFP expression decreased amount, abnormal nomozf3952/zf3952; ion84Tg/ion84Tg standard conditions Figure 5 with image from Zhang et al., 2024
forebrain GABAergic neuron EGFP expression decreased amount, abnormal nomozf3952/zf3952; ion84Tg/ion84Tg standard conditions Figure 5 with image from Zhang et al., 2024
midbrain GABAergic neuron EGFP expression decreased amount, abnormal nomozf3952/zf3952; ion84Tg/ion84Tg standard conditions Figure 5 with image from Zhang et al., 2024
midbrain glutamatergic neuron DsRed expression decreased amount, abnormal nomozf3952/zf3952; nns14Tg/nns14Tg standard conditions Figure 5 with image from Zhang et al., 2024
forebrain glutamatergic neuron DsRed expression decreased amount, abnormal nomozf3952/zf3952; nns14Tg/nns14Tg standard conditions Figure 5 with image from Zhang et al., 2024
spinal cord glutamatergic neuron DsRed expression decreased amount, abnormal nomozf3952/zf3952; nns14Tg/nns14Tg standard conditions Figure 5 with image from Zhang et al., 2024
hindbrain glutamatergic neuron DsRed expression decreased amount, abnormal nomozf3952/zf3952; nns14Tg/nns14Tg standard conditions Figure 5 with image from Zhang et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.