CRISPR

CRISPR5-pdgfrb

ID

ZDB-CRISPR-241023-2

Name

CRISPR5-pdgfrb

Previous Names

None

Target

pdgfrb (1)

Sequence

5' - TGTACCCCAATGTCATGGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end. This CRISPR was designed for the AB background..

Genome Resources

None

Target Location

View all 6 target locations

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ion33dTg	pdgfrb

Expression

Gene expression in Wild Types + CRISPR5-pdgfrb

No data available

Phenotype

Phenotype resulting from CRISPR5-pdgfrb

No data available

Phenotype of all Fish created by or utilizing CRISPR5-pdgfrb

Phenotype	Fish	Conditions	Figures
midbrain pericyte GFP expression increased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; ion252dTg/ion252dTg; um13Tg/um13Tg	standard conditions	Fig. 5 from Zi et al., 2024
pericyte cell division increased frequency, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; ion252dTg/ion252dTg; um13Tg/um13Tg	standard conditions	Fig. 5 from Zi et al., 2024
brain vasculature pericyte GFP expression increased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: yoda 1	Fig. 2 from Zi et al., 2024
pericyte cell division decreased frequency, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: DAPT	Fig. 4 from Zi et al., 2024
midbrain pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: DAPT, chemical treatment by environment: yoda 1	Fig. 4 from Zi et al., 2024
midbrain pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: DAPT, chemical treatment by environment: Epinephrine bitartrate	Fig. 4 from Zi et al., 2024
brain vasculature pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	standard conditions	Fig. 2 from Zi et al., 2024
brain vasculature pericyte GFP expression increased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: Epinephrine bitartrate	Fig. 1 from Zi et al., 2024
midbrain pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: DAPT	Fig. 4 from Zi et al., 2024
brain vasculature pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: diacetylmonoxime	Fig. 1 from Zi et al., 2024
pericyte cell division increased frequency, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: yoda 1	Fig. 2 from Zi et al., 2024
brain pericyte decreased amount, abnormal	cd248a^cc11/cc11; pdgfrb^ion33dTg; c369Tg	chemical treatment by environment: 6,7-dimethyl-2-phenylquinoxaline	Fig. 6 from Wang et al., 2025
pericyte cell population proliferation decreased occurrence, abnormal	cd248a^cc11/cc11; pdgfrb^ion33dTg; c369Tg	standard conditions	Fig. 6 from Wang et al., 2025
brain pericyte decreased amount, abnormal	cd248a^cc11/cc11; pdgfrb^ion33dTg; c369Tg; um13Tg	standard conditions	Fig. 4 , Fig. 5 from Wang et al., 2025
trunk pericyte decreased amount, abnormal	cd248a^cc11/cc11; pdgfrb^ion33dTg; c369Tg; um13Tg	standard conditions	Fig. 4 from Wang et al., 2025
endothelial blood brain barrier increased permeability, abnormal	cd248a^cc11/cc11; pdgfrb^ion33dTg; c369Tg; um13Tg	standard conditions	Fig. 5 from Wang et al., 2025
midbrain pericyte GFP expression amount, ameliorated	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; ion258dTg/ion258dTg; um13Tg/um13Tg	chemical treatment by environment: Epinephrine bitartrate	Fig. 5 from Zi et al., 2024
midbrain pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; ion258dTg/ion258dTg; um13Tg/um13Tg	standard conditions	Fig. 5 from Zi et al., 2024
midbrain pericyte GFP expression amount, ameliorated	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; ion258dTg/ion258dTg; um13Tg/um13Tg	chemical treatment by environment: yoda 1	Fig. 5 from Zi et al., 2024
pericyte cell division decreased frequency, abnormal	pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; ion258dTg/ion258dTg; um13Tg/um13Tg	standard conditions	Fig. 5 from Zi et al., 2024
brain vasculature pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; piezo1^{ion204dTg/ion204dTg}; c369Tg/c369Tg; s898Tg/s898Tg; um13Tg/um13Tg	chemical treatment by environment: yoda 1	Fig. 3 from Zi et al., 2024
brain vasculature pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; piezo1^{ion204dTg/ion204dTg}; c369Tg/c369Tg; s898Tg/s898Tg; um13Tg/um13Tg	chemical treatment by environment: Epinephrine bitartrate	Fig. 3 from Zi et al., 2024
brain vasculature pericyte GFP expression decreased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; piezo1^{ion204dTg/ion204dTg}; c369Tg/c369Tg; s898Tg/s898Tg; um13Tg/um13Tg	standard conditions	Fig. 3 from Zi et al., 2024
pericyte cell division decreased frequency, abnormal	pdgfrb^{ion33dTg/ion33dTg}; piezo1^{ion204dTg/ion204dTg}; c369Tg/c369Tg; s898Tg/s898Tg; um13Tg/um13Tg	standard conditions	Fig. 3 from Zi et al., 2024
midbrain blood vessel DsRedx expression increased amount, abnormal	pdgfrb^{ion33dTg/ion33dTg}; piezo1^{ion204dTg/ion204dTg}; c369Tg/c369Tg; s898Tg/s898Tg; um13Tg/um13Tg	standard conditions	Fig. 3 from Zi et al., 2024
brain vasculature pericyte GFP expression amount, ameliorated	piezo1^{ion89d/ion89d}; pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: diacetylmonoxime	Fig. 2 from Zi et al., 2024
pericyte cell division decreased frequency, abnormal	piezo1^{ion89d/ion89d}; pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	standard conditions	Fig. 2 from Zi et al., 2024
midbrain blood vessel DsRedx expression increased amount, abnormal	piezo1^{ion89d/ion89d}; pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	standard conditions	Fig. 3 from Zi et al., 2024
brain vasculature pericyte GFP expression decreased amount, abnormal	piezo1^{ion89d/ion89d}; pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	standard conditions	Fig. 2 from Zi et al., 2024
brain vasculature pericyte GFP expression amount, ameliorated	piezo1^{ion89d/ion89d}; pdgfrb^{ion33dTg/ion33dTg}; c369Tg/c369Tg; um13Tg/um13Tg	chemical treatment by environment: Epinephrine bitartrate	Fig. 2 from Zi et al., 2024
brain pericyte decreased amount, abnormal	cd248a^cc11/cc11; cd248b^cc12/cc12; pdgfrb^ion33dTg; c369Tg; um13Tg	standard conditions	Fig. 4 from Wang et al., 2025
trunk pericyte decreased amount, abnormal	cd248a^cc11/cc11; cd248b^cc12/cc12; pdgfrb^ion33dTg; c369Tg; um13Tg	standard conditions	Fig. 4 from Wang et al., 2025

Citations