CRISPR

CRISPR3-mcf2lb

ID
ZDB-CRISPR-241010-3
Name
CRISPR3-mcf2lb
Previous Names
None
Target
Sequence
5' - GGGCTCAGTGGAGCTGCAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nl25 mcf2lb
nl26 mcf2lb
Expression
Gene expression in Wild Types + CRISPR3-mcf2lb
No data available
Phenotype
Phenotype resulting from CRISPR3-mcf2lb
No data available
Phenotype of all Fish created by or utilizing CRISPR3-mcf2lb
Phenotype Fish Conditions Figures
lateral line primordium apical part of cell ab1-myl-ser19-p labeling decreased amount, abnormal mcf2lbnl25/nl25; zf106Tg/zf106Tg standard conditions Fig. 9. with image from Olson et al., 2024
lateral line primordium apical part of cell Ab1-rock2a labeling spatial pattern, abnormal mcf2lbnl25/nl25; zf106Tg/zf106Tg standard conditions Fig. 9. with image from Olson et al., 2024
neuromast primordium migration decreased process quality, abnormal mcf2lbnl25/nl25; zf106Tg/zf106Tg standard conditions Fig. 4. with image from Olson et al., 2024
lateral line primordium apical part of cell ab1-tjp1 labeling spatial pattern, abnormal mcf2lbnl25/nl25; zf106Tg/zf106Tg standard conditions Fig. 7. with image from Olson et al., 2024
lateral line primordium apical part of cell EGFP expression spatial pattern, abnormal mcf2lbnl25/nl25; zf106Tg/zf106Tg standard conditions Fig. 4. with image,  Fig. 5. with image from Olson et al., 2024
lateral line primordium apical part of cell ab1-myl-ser19-p labeling decreased amount, abnormal mcf2lbnl26/nl26; zf106Tg/zf106Tg standard conditions Fig. 9. with image from Olson et al., 2024
lateral line primordium apical part of cell Ab1-rock2a labeling spatial pattern, abnormal mcf2lbnl26/nl26; zf106Tg/zf106Tg standard conditions Fig. 9. with image from Olson et al., 2024
neuromast primordium migration decreased process quality, abnormal mcf2lbnl26/nl26; zf106Tg/zf106Tg standard conditions Fig. 4. with image from Olson et al., 2024
lateral line primordium apical part of cell ab1-tjp1 labeling spatial pattern, abnormal mcf2lbnl26/nl26; zf106Tg/zf106Tg standard conditions Fig. 7. with image from Olson et al., 2024
lateral line primordium apical part of cell EGFP expression spatial pattern, abnormal mcf2lbnl26/nl26; zf106Tg/zf106Tg standard conditions Fig. 4. with image,  Fig. 5. with image from Olson et al., 2024
neuromast cell decreased amount, abnormal mcf2lbnl25/nl25; sk115Tg/sk115Tg; zf106Tg/zf106Tg standard conditions Fig. 3. with image from Olson et al., 2024
neuromast EGFP expression increased amount, abnormal mcf2lbnl25/nl25; sk115Tg/sk115Tg; zf106Tg/zf106Tg standard conditions Fig. 3. with image from Olson et al., 2024
lateral line primordium apical part of cell EGFP expression spatial pattern, abnormal mcf2lbnl25/nl25; sk115Tg/sk115Tg; zf106Tg/zf106Tg standard conditions Fig. 3. with image from Olson et al., 2024
lateral line primordium Rho-dependent protein serine/threonine kinase activity decreased occurrence, abnormal mcf2lbnl25/nl25; sk122Tg/sk122Tg; sk85Tg/sk85Tg standard conditions Fig. 8. with image from Olson et al., 2024
lateral line primordium apical part of cell EGFP expression spatial pattern, abnormal mcf2lbnl25/nl25; sk122Tg/sk122Tg; sk85Tg/sk85Tg standard conditions Fig. 8. with image from Olson et al., 2024
neuromast cell decreased amount, abnormal mcf2lbnl26/nl26; sk115Tg/sk115Tg; zf106Tg/zf106Tg standard conditions Fig. 3. with image from Olson et al., 2024
neuromast EGFP expression increased amount, abnormal mcf2lbnl26/nl26; sk115Tg/sk115Tg; zf106Tg/zf106Tg standard conditions Fig. 3. with image from Olson et al., 2024
lateral line primordium Rho-dependent protein serine/threonine kinase activity decreased occurrence, abnormal mcf2lbnl26/nl26; sk122Tg/sk122Tg; sk85Tg/sk85Tg standard conditions Fig. 8. with image from Olson et al., 2024
lateral line primordium apical part of cell EGFP expression spatial pattern, abnormal mcf2lbnl26/nl26; sk122Tg/sk122Tg; sk85Tg/sk85Tg standard conditions Fig. 8. with image from Olson et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.