CRISPR

CRISPR3-stat5a

ID

ZDB-CRISPR-240812-2

Name

CRISPR3-stat5a

Previous Names

None

Target

stat5a (1)

Sequence

5' - GGCACTACTTGTTTGATTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mdu032	stat5a
mdu033	stat5a

Expression

Gene expression in Wild Types + CRISPR3-stat5a

No data available

Phenotype

Phenotype resulting from CRISPR3-stat5a

No data available

Phenotype of all Fish created by or utilizing CRISPR3-stat5a

Phenotype	Fish	Conditions	Figures
whole organism fasn expression increased amount, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 3 from Awasthi et al., 2023
male organism decreased length, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 3 from Awasthi et al., 2023
thymus lck expression decreased amount, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 2 from Awasthi et al., 2023
spleen male organism ighm expression decreased amount, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 2 from Awasthi et al., 2023
whole organism igf1 expression decreased amount, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 3 from Awasthi et al., 2023
kidney male organism cd8a expression decreased amount, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 2 from Awasthi et al., 2023
female organism decreased weight, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 3 from Awasthi et al., 2023
female organism decreased length, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 3 from Awasthi et al., 2023
male organism decreased weight, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 3 from Awasthi et al., 2023
thymus rag1 expression decreased amount, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 2 from Awasthi et al., 2023
female organism lipid increased amount, abnormal	stat5a^{mdu032/mdu032}	standard conditions	Fig. 3 from Awasthi et al., 2023
female organism lipid increased amount, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 3 from Awasthi et al., 2023
thymus rag1 expression decreased amount, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 2 from Awasthi et al., 2023
whole organism fasn expression increased amount, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 3 from Awasthi et al., 2023
male organism decreased length, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 3 from Awasthi et al., 2023
thymus lck expression decreased amount, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 2 from Awasthi et al., 2023
kidney male organism cd8a expression decreased amount, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 2 from Awasthi et al., 2023
female organism decreased weight, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 3 from Awasthi et al., 2023
whole organism igf1 expression increased amount, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 3 from Awasthi et al., 2023
kidney male organism trac expression decreased amount, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 2 from Awasthi et al., 2023
male organism decreased weight, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 3 from Awasthi et al., 2023
female organism decreased length, abnormal	stat5a^{mdu033/mdu033}	standard conditions	Fig. 3 from Awasthi et al., 2023

Citations