CRISPR

CRISPR1-vsx2

ID

ZDB-CRISPR-240605-3

Name

CRISPR1-vsx2

Previous Names

None

Target

vsx2 (1)

Sequence

5' - GGTGCCGGAGGACAGAATAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
upo372	vsx2

Expression

Gene expression in Wild Types + CRISPR1-vsx2

No data available

Phenotype

Phenotype resulting from CRISPR1-vsx2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-vsx2

Phenotype	Fish	Conditions	Figures
retinal inner plexiform layer hypoplastic, abnormal	vsx1^{upo371/upo371}; vsx2^upo372/+	standard conditions	Fig. 1 from Letelier et al., 2023
whole organism decreased life span, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	text only from Letelier et al., 2023
retinal inner nuclear layer vsx2 expression increased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 5 - Supplemental 1 from Letelier et al., 2023
retinal outer plexiform layer disorganized, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 1 from Letelier et al., 2023
retina vsx2 expression increased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 5 - Supplemental 1 from Letelier et al., 2023
retinal inner nuclear layer retinal bipolar neuron decreased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 4 from Letelier et al., 2023
retina vsx1 expression increased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 5 - Supplemental 1 from Letelier et al., 2023
whole organism vsx1 expression increased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 5 from Letelier et al., 2023
whole organism vsx2 expression decreased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 5 from Letelier et al., 2023
retinal inner nuclear layer decreased thickness, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 1 from Letelier et al., 2023
retinal outer nuclear layer increased thickness, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 1 from Letelier et al., 2023
visual perception decreased process quality, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 2 from Letelier et al., 2023
retina cell population proliferation increased occurrence, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 3 from Letelier et al., 2023
retinal inner nuclear layer vsx1 expression decreased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 5 - Supplemental 1 from Letelier et al., 2023
retinal inner nuclear layer apoptotic process increased occurrence, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 3 from Letelier et al., 2023
ciliary marginal zone vsx2 expression increased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 5 - Supplemental 1 from Letelier et al., 2023
retinal inner nuclear layer Muller cell increased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 4 from Letelier et al., 2023
retinal inner plexiform layer disorganized, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 1 from Letelier et al., 2023
eye decreased functionality, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 2 from Letelier et al., 2023
optic cup vsx1 expression increased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 5 - Supplemental 1 from Letelier et al., 2023
retinal inner nuclear layer retinal bipolar neuron prkcbb expression decreased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 4 from Letelier et al., 2023
retinal inner nuclear layer Muller cell gfap expression increased amount, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 4 from Letelier et al., 2023
retinal outer plexiform layer structurally discontinuous, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 1 from Letelier et al., 2023
visually-mediated background adaptation process quality, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 1 from Letelier et al., 2023
retinal inner plexiform layer structurally discontinuous, abnormal	vsx1^{upo371/upo371}; vsx2^{upo372/upo372}	standard conditions	Fig. 1 from Letelier et al., 2023

Citations