CRISPR

CRISPR2-stat5a

ID

ZDB-CRISPR-240507-6

Name

CRISPR2-stat5a

Previous Names

None

Target

stat5a (1)

Sequence

5' - GGAGCTGCGAATACTGACTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mdu022	stat5a

Expression

Gene expression in Wild Types + CRISPR2-stat5a

No data available

Phenotype

Phenotype resulting from CRISPR2-stat5a

No data available

Phenotype of all Fish created by or utilizing CRISPR2-stat5a

Phenotype	Fish	Conditions	Figures
whole organism igf2a expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
whole organism fasn expression increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Awasthi et al., 2023
spleen nkl.4 expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
head kidney lymphocyte decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
spleen ighm expression increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
thymus trac expression decreased distribution, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
female organism decreased weight, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Awasthi et al., 2023
female organism kidney stat5a expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 1 from Heidary et al., 2023
kidney male organism trac expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Awasthi et al., 2023
whole organism gh1 expression increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
female organism decreased length, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
whole organism fasn expression increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
thymus rag1 expression decreased distribution, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
head kidney ikzf4 expression increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
male organism decreased weight, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Awasthi et al., 2023
whole organism decreased length, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
male organism decreased length, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
spleen nkl.2 expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
spleen cd8a expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
thymus lck expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Awasthi et al., 2023
fertilized egg decreased size, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
female organism liver stat5a expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 1 from Heidary et al., 2023
spleen male organism cd8a expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Awasthi et al., 2023
male organism decreased length, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Awasthi et al., 2023
kidney male organism cd8a expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Awasthi et al., 2023
whole organism lipid droplet increased distribution, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
spleen trac expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
female organism decreased length, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Awasthi et al., 2023
whole organism srebf1 expression increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
head kidney cd8a expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
thymus ikzf1 expression decreased distribution, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
head kidney trac expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
thymus rag1 expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Awasthi et al., 2023
female organism lipid increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023
head kidney cd28 expression increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Heidary et al., 2023
female organism lipid increased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Awasthi et al., 2023
whole organism igf2a expression decreased amount, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 3 from Awasthi et al., 2023
female organism decreased weight, abnormal	stat5a^{mdu022/mdu022}	standard conditions	Fig. 2 from Heidary et al., 2023

Citations