CRISPR

CRISPR15- chd7

ID
ZDB-CRISPR-230919-4
Name
CRISPR15- chd7
Previous Names
None
Target
Sequence
5' - GCACCATGATATCGGGAATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ah517 chd7
Expression
Gene expression in Wild Types + CRISPR15- chd7
No data available
Phenotype
Phenotype resulting from CRISPR15- chd7
No data available
Phenotype of all Fish created by or utilizing CRISPR15- chd7
Phenotype Fish Conditions Figures
post-vent region curved, abnormal chd7ah517/ah517 (AB) standard conditions Figure 3 with image from Shi et al., 2023
neuron myelin sheath decreased thickness, abnormal chd7ah517/ah517 (AB) standard conditions Figure 6 with image from Shi et al., 2023
whole organism mbpa expression decreased amount, abnormal chd7ah517/ah517 (AB) standard conditions Figure 5 with image from Shi et al., 2023
eye morphology, abnormal chd7ah517/ah517 (AB) standard conditions Figure 3 with image from Shi et al., 2023
Mauthner neuron myelin sheath decreased thickness, abnormal chd7ah517/ah517 (AB) standard conditions Figure 6 with image from Shi et al., 2023
whole organism isl2a expression increased amount, abnormal chd7ah517/ah517 (AB) standard conditions Figure 3 with image from Shi et al., 2023
pericardium edematous, abnormal chd7ah517/ah517 (AB) standard conditions Figure 3 with image from Shi et al., 2023
whole organism flnbb expression decreased amount, abnormal chd7ah517/ah517 (AB) standard conditions Figure 7 with image from Shi et al., 2023
whole organism nr4a1 expression decreased amount, abnormal chd7ah517/ah517 (AB) standard conditions Figure 7 with image from Shi et al., 2023
swimming behavior increased process quality, abnormal chd7ah517/ah517 (AB) standard conditions Figure 3 with image from Shi et al., 2023
whole organism tnfrsf1a expression increased amount, abnormal chd7ah517/ah517 (AB) standard conditions Figure 7 with image from Shi et al., 2023
whole organism olig2 expression decreased amount, abnormal chd7ah517/ah517 (AB) standard conditions Figure 5 with image from Shi et al., 2023
whole organism isl1a expression increased amount, abnormal chd7ah517/ah517 (AB) standard conditions Figure 3 with image from Shi et al., 2023
head decreased size, abnormal chd7ah517/ah517 (AB) standard conditions Figure 3 with image from Shi et al., 2023
Mauthner neuron myelin sheath decreased distribution, abnormal chd7ah517/ah517; ue2Tg (AB) standard conditions Figure 5 with image from Shi et al., 2023
Mauthner neuron myelination decreased process quality, abnormal chd7ah517/ah517; ue2Tg (AB) standard conditions Figure 5 with image from Shi et al., 2023
somitogenesis delayed, abnormal chd7ah517/ah517; ue2Tg (AB) standard conditions Figure 5 with image from Shi et al., 2023
spinal cord oligodendrocyte decreased amount, abnormal chd7ah517/ah517; vu12Tg (AB) standard conditions Figure 4 with image from Shi et al., 2023
Citations