CRISPR

CRISPR6-nkx3-2

ID
ZDB-CRISPR-230406-1
Name
CRISPR6-nkx3-2
Previous Names
None
Target
Sequence
5' - GATCAGGAATCCGCGGCCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uu2803 nkx3-2
Expression
Gene expression in Wild Types + CRISPR6-nkx3-2
No data available
Phenotype
Phenotype resulting from CRISPR6-nkx3-2
No data available
Phenotype of all Fish created by or utilizing CRISPR6-nkx3-2
Phenotype Fish Conditions Figures
scaphium absence of anatomical entity, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 8 with image from Waldmann et al., 2021
mouth open, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 1 with imageFig 5 with imageFig 6 with image from Waldmann et al., 2021
palatoquadrate cartilage increased thickness, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 4 with image from Waldmann et al., 2021
palatoquadrate cartilage chondrocyte circular, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 2 with image from Waldmann et al., 2021
basioccipital fused with exoccipital, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 8 with image from Waldmann et al., 2021
vertebra 1 absence of anatomical entity, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 8 with image from Waldmann et al., 2021
mandibular symphysis increased thickness, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 6 with image from Waldmann et al., 2021
mandibular symphysis deformed, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 6 with image from Waldmann et al., 2021
tripus deformed, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 8 with image from Waldmann et al., 2021
Meckel's cartilage-palatoquadrate cartilage joint increased mass density, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 4 with image from Waldmann et al., 2021
palatoquadrate cartilage chondrocyte decreased size, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 2 with image from Waldmann et al., 2021
palatoquadrate cartilage chondrocyte disorganized, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 2 with image from Waldmann et al., 2021
Meckel's cartilage-palatoquadrate cartilage joint fused with Meckel's cartilage-palatoquadrate cartilage joint, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 2 with imageFig 3 with imageFig 4 with imageFig 5 with image from Waldmann et al., 2021
palatoquadrate cartilage increased intensity, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 4 with image from Waldmann et al., 2021
Meckel's cartilage-palatoquadrate cartilage joint chondrocyte aligned with Meckel's cartilage-palatoquadrate cartilage joint chondrocyte, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 3 with image from Waldmann et al., 2021
vertebra 2 parapophysis 2 decreased size, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 8 with image from Waldmann et al., 2021
Meckel's cartilage-palatoquadrate cartilage joint chondrocyte hypertrophic, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 3 with image from Waldmann et al., 2021
vertebra parapophysis absence of anatomical entity, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 7 with image from Waldmann et al., 2021
Meckel's cartilage intensity, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 4 with image from Waldmann et al., 2021
auditory capsule posterior side decreased length, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 4 with image from Waldmann et al., 2021
Meckel's cartilage-palatoquadrate cartilage joint cartilage tissue increased intensity, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 4 with image from Waldmann et al., 2021
basioccipital anterior region convex, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 8 with image from Waldmann et al., 2021
retroarticular process absence of anatomical entity, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 2 with imageFig 5 with image from Waldmann et al., 2021
cranium morphology, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 6 with image from Waldmann et al., 2021
exoccipital fused with exoccipital, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 8 with image from Waldmann et al., 2021
claustrum bone absence of anatomical entity, abnormal nkx3-2uu2803/uu2803; ba2Tg (AB) standard conditions Fig 8 with image from Waldmann et al., 2021
Meckel's cartilage-palatoquadrate cartilage joint malformed, abnormal nkx3-2uu2803/uu2803; ba2Tg; zf3982Tg standard conditions Figure 4. with image from Leyhr et al., 2022
Meckel's cartilage-palatoquadrate cartilage joint embryonic skeletal joint morphogenesis decreased process quality, abnormal nkx3-2uu2803/uu2803; ba2Tg; zf3982Tg standard conditions Figure 4. with image from Leyhr et al., 2022
Meckel's cartilage posterior margin fused with palatoquadrate cartilage anterior margin, abnormal nkx3-2uu2803/uu2803; ba2Tg; zf3982Tg standard conditions Figure 4. with image from Leyhr et al., 2022
Citations