CRISPR

CRISPR1-ap1g1

ID
ZDB-CRISPR-230130-1
Name
CRISPR1-ap1g1
Previous Names
None
Target
Sequence
5' - GACGGCTCGAACCCAGGCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ubx2 ap1g1
Expression
Gene expression in Wild Types + CRISPR1-ap1g1
No data available
Phenotype
Phenotype resulting from CRISPR1-ap1g1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ap1g1
Phenotype Fish Conditions Figures
whole organism dead, abnormal ap1g1ubx2/ubx2 (AB) standard conditions Figure 6 with image from Imperatore et al., 2025
Figure 1 with imageFigure 2 with image from Mignani et al., 2023
whole organism ap1g1 expression decreased amount, abnormal ap1g1ubx2/ubx2 (AB) standard conditions Figure 1 with image from Mignani et al., 2023
blastomere morphology, abnormal ap1g1ubx2/ubx2 (AB) standard conditions Figure 1 with image from Mignani et al., 2023
whole organism bmp7a expression decreased amount, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 7 with image from Mignani et al., 2023
intestinal epithelium detached from intestinal lamina propria mucosa, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 4 with image from Mignani et al., 2023
male organism decreased male fertility, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 3 with image from Mignani et al., 2023
intestine columnar/cuboidal epithelial cell morphology, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 4 with image from Mignani et al., 2023
intestinal lamina propria mucosa disorganized, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 4 with image from Mignani et al., 2023
whole organism bmp2b expression decreased amount, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 7 with image from Mignani et al., 2023
ovary disorganized, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 3 with image from Mignani et al., 2023
testis ap1g1 expression decreased amount, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 3 with image from Mignani et al., 2023
whole organism decreased weight, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 4 with image from Mignani et al., 2023
whole organism bmp4 expression decreased amount, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 7 with image from Mignani et al., 2023
ovary ap1g1 expression decreased amount, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 3 with image from Mignani et al., 2023
whole organism cdh1 expression decreased amount, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 7 with image from Mignani et al., 2023
intestine lumen goblet cell morphology, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 4 with image from Mignani et al., 2023
oocyte degenerate, abnormal ap1g1ubx2/+ (AB) standard conditions Figure 3 with image from Mignani et al., 2023
midbrain EGFP expression decreased distribution, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 5 with image from Mignani et al., 2023
spinal cord EGFP expression decreased distribution, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 5 with image from Mignani et al., 2023
telencephalon neuron decreased amount, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 5 with image from Mignani et al., 2023
telencephalon anterior region EGFP expression decreased distribution, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 5 with image from Mignani et al., 2023
brain decreased volume, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 6 with image from Mignani et al., 2023
midbrain hindbrain boundary neuron decreased amount, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 5 with image from Mignani et al., 2023
midbrain hindbrain boundary EGFP expression decreased distribution, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 5 with image from Mignani et al., 2023
spinal cord neuron decreased amount, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 5 with image from Mignani et al., 2023
midbrain neuron decreased amount, abnormal ap1g1ubx2/+; nl1Tg (AB) standard conditions Figure 5 with image from Mignani et al., 2023
Citations