CRISPR

CRISPR2-nr4a1

ID
ZDB-CRISPR-230106-1
Name
CRISPR2-nr4a1
Previous Names
None
Target
Sequence
5' - GAAGGAGTCCAGCTGCCCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
xmu201 nr4a1
Expression
Gene expression in Wild Types + CRISPR2-nr4a1
No data available
Phenotype
Phenotype resulting from CRISPR2-nr4a1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-nr4a1
Phenotype Fish Conditions Figures
whole organism gpib expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 5 with image from Xu et al., 2022
whole organism insb expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 6 with image from Xu et al., 2022
whole organism chia.4 expression increased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 5 with image from Xu et al., 2022
whole organism glucose increased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 5 with image from Xu et al., 2022
whole organism hmgcs1 expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with imageFigure 4 with imageFigure 5 with image from Xu et al., 2022
whole organism chia.5 expression increased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 5 with image from Xu et al., 2022
whole organism leucine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism lss expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with image from Xu et al., 2022
whole organism lysine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism alanine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism ugt5a1 expression increased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with image from Xu et al., 2022
whole organism ldha expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism cyp51 expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with image from Xu et al., 2022
whole organism aldoaa expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 5 with image from Xu et al., 2022
whole organism proline decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism pygma expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 5 with image from Xu et al., 2022
whole organism tyrosine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism cyp2p9 expression increased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with image from Xu et al., 2022
whole organism phenylalanine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism aox5 expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism methionine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism cholesterol increased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with image from Xu et al., 2022
whole organism triglyceride increased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with image from Xu et al., 2022
whole organism hadhaa expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with imageFigure 4 with imageFigure 5 with image from Xu et al., 2022
whole organism serine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism histidine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism sqlea expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with image from Xu et al., 2022
whole organism isoleucine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism asparagine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism sc5d expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with image from Xu et al., 2022
whole organism glutamic acid decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
whole organism pfkmb expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 5 with image from Xu et al., 2022
whole organism aglb expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 5 with image from Xu et al., 2022
whole organism ugt5a5 expression decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 4 with imageFigure 5 with image from Xu et al., 2022
whole organism valine decreased amount, abnormal nr4a1xmu201/xmu201 (AB) standard conditions Figure 3 with image from Xu et al., 2022
insulin secretion involved in cellular response to glucose stimulus disrupted, abnormal nr4a1xmu201/xmu201; tud202Tg; vu513Tg standard conditions Figure 6 with image from Xu et al., 2022
pancreatic B cell decreased amount, abnormal nr4a1xmu201/xmu201; vu513Tg standard conditions Figure 6 with image from Xu et al., 2022
pancreatic B cell mCherry expression amount, ameliorated nr4a1xmu201/xmu201; ia1Tg; xmu202Tg standard conditions Figure 7 with image from Xu et al., 2022
pancreatic B cell amount, ameliorated nr4a1xmu201/xmu201; vu513Tg; xmu202Tg standard conditions Figure 7 with image from Xu et al., 2022
Citations