CRISPR

CRISPR2-lpgat1

ID

ZDB-CRISPR-221209-2

Name

CRISPR2-lpgat1

Previous Names

None

Target

lpgat1 (1)

Sequence

5' - TTTCTTAGGAAACCGCCTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3666	lpgat1

Expression

Gene expression in Wild Types + CRISPR2-lpgat1

No data available

Phenotype

Phenotype resulting from CRISPR2-lpgat1

No data available

Phenotype of all Fish created by or utilizing CRISPR2-lpgat1

Phenotype	Fish	Conditions	Figures
whole organism phosphatidylserine 40:7 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidic acid 40:6 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 40:6 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 38:3 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 38:6 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 36:1 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 36:4 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 38:5 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 36:1 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism semi-viable, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 4 from Shibata et al., 2022
whole organism phosphatidylethanolamine 36:4 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylglycerol 40:5 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 32:1 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylinositol 34:2 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylcholine 36:1 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 32:0 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylcholine 40:5 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 40:5 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 36:3 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylinositol 34:0 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 40:5 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 38:4 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 34:1 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 36:3 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylcholine 34:0 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 38:5 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 34:0 zwitterion increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism dead, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 4 from Shibata et al., 2022
whole organism phosphatidylcholine 40:6 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylglycerol 34:2 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 38:4 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 34:1 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 40:6 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 38:6 increased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylglycerol 32:1 decreased amount, abnormal	lpgat1^{zf3666/zf3666} (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 40:7 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
sperm sperm midpiece loose, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 3 from Shibata et al., 2022
male organism decreased male fertility, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 2 from Shibata et al., 2022
whole organism phosphatidylserine 38:3 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 38:6 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 40:6 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 38:5 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 36:4 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 36:1 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 32:1 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylinositol 34:2 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 32:0 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 36:3 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 40:5 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
sperm phosphatidylethanolamine 40:6 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 7 from Shibata et al., 2022
sperm phosphatidylethanolamine 36:4 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 7 from Shibata et al., 2022
sperm decreased cellular motility, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 3 from Shibata et al., 2022
whole organism phosphatidylserine 40:5 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 36:3 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 38:5 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
sperm phosphatidylcholine 32:0 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 7 from Shibata et al., 2022
whole organism phosphatidylethanolamine 40:6 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 38:4 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylethanolamine 38:6 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
whole organism phosphatidylserine 34:1 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022
sperm phosphatidylethanolamine 36:3 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 7 from Shibata et al., 2022
sperm phosphatidylcholine 36:3 increased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 7 from Shibata et al., 2022
sperm phosphatidylethanolamine 40:5 decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 7 from Shibata et al., 2022
whole organism phosphatidylserine 34:0(1-) decreased amount, abnormal	lpgat1^zf3666/+ (AB)	standard conditions	Figure 6 from Shibata et al., 2022

Citations