CRISPR

CRISPR1-inhbab

ID
ZDB-CRISPR-220815-6
Name
CRISPR1-inhbab
Previous Names
None
Target
Sequence
5' - GGGCAGCACACTGTCAGTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umo28 inhbab
Expression
Gene expression in Wild Types + CRISPR1-inhbab
No data available
Phenotype
Phenotype resulting from CRISPR1-inhbab
No data available
Phenotype of all Fish created by or utilizing CRISPR1-inhbab
Phenotype Fish Conditions Figures
female organism hypophysis fshb expression increased amount, abnormal inhbaaumo27/umo27; inhbabumo28/+ (AB) standard conditions Fig 14 with image from Zhao et al., 2022
ovary tnfa expression increased amount, abnormal inhbaaumo27/umo27; inhbabumo28/+ (AB) standard conditions Fig 13 with image from Zhao et al., 2022
ovary apoptotic, abnormal inhbaaumo27/umo27; inhbabumo28/+ (AB) standard conditions Fig 13 with image from Zhao et al., 2022
ovary il6 expression increased amount, abnormal inhbaaumo27/umo27; inhbabumo28/+ (AB) standard conditions Fig 13 with image from Zhao et al., 2022
ovary cyp19a1a expression increased amount, abnormal inhbaaumo27/umo27; inhbabumo28/+ (AB) standard conditions Fig 14 with image from Zhao et al., 2022
female organism hypophysis fshb expression increased amount, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 14 with image from Zhao et al., 2022
ovarian follicle increased distance ovarian follicle, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 5 with image from Zhao et al., 2022
granulosa cell hypertrophic, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 5 with image from Zhao et al., 2022
oocyte stage III decreased amount, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 7 with image from Zhao et al., 2022
female organism developmental process involved in reproduction delayed, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 3 with image,  Fig 4 with image from Zhao et al., 2022
ovarian follicle ovarian follicle development disrupted, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 3 with image from Zhao et al., 2022
ovarian follicle stage II absent, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 3 with image from Zhao et al., 2022
ovarian follicle development disrupted, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 6 with image from Zhao et al., 2022
ovary stromal cell increased amount, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 6 with image,  Fig 7 with image,  Fig 8 with image from Zhao et al., 2022
oocyte stage II absent, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 6 with image from Zhao et al., 2022
female organism decreased fecundity, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 7 with image from Zhao et al., 2022
ovarian follicle atretic, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 5 with image,  Fig 8 with image from Zhao et al., 2022
ovarian follicle degeneration, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 5 with image,  Fig 8 with image from Zhao et al., 2022
oocyte stage III absent, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 6 with image from Zhao et al., 2022
female organism decreased length, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 7 with image from Zhao et al., 2022
oocyte stage I increased amount, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 4 with image,  Fig 7 with image from Zhao et al., 2022
whole organism dead, exacerbated inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 1 with image from Zhao et al., 2022
ovary cyp19a1a expression increased amount, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 14 with image from Zhao et al., 2022
granulosa cell layer hypertrophic, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 5 with image from Zhao et al., 2022
oocyte stage II decreased amount, abnormal inhbaaumo27/umo27; inhbabumo28/umo28 (AB) standard conditions Fig 4 with image,  Fig 7 with image from Zhao et al., 2022
oocyte stage III decreased amount, abnormal inhbbumo29/umo29; inhbabumo28/+ (AB) standard conditions Fig 12 with image from Zhao et al., 2022
oocyte stage II increased amount, abnormal inhbbumo29/umo29; inhbabumo28/+ (AB) standard conditions Fig 12 with image from Zhao et al., 2022
oocyte stage III decreased amount, abnormal inhbbumo29/umo29; inhbabumo28/umo28 (AB) standard conditions Fig 12 with image from Zhao et al., 2022
oocyte stage II increased amount, abnormal inhbbumo29/umo29; inhbabumo28/umo28 (AB) standard conditions Fig 12 with image from Zhao et al., 2022
whole organism dead, exacerbated inhbaaumo27/umo27; inhbbumo29/umo29; inhbabumo28/umo28 (AB) standard conditions Fig 1 with image from Zhao et al., 2022
Citations