CRISPR

CRISPR4-chd7

ID
ZDB-CRISPR-220331-16
Name
CRISPR4-chd7
Previous Names
None
Target
Sequence
5' - TGTATTCCTGCTGTGCACAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
iaf17 chd7
Expression
Gene expression in Wild Types + CRISPR4-chd7
No data available
Phenotype
Phenotype resulting from CRISPR4-chd7
No data available
Phenotype of all Fish created by or utilizing CRISPR4-chd7
Phenotype Fish Conditions Figures
ventral mandibular arch decreased length, abnormal chd7iaf17/iaf17 standard conditions Fig. 1 with image from Breuer et al., 2024
whole organism runx2b expression decreased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
parasphenoid bone mineralization decreased process quality, abnormal chd7iaf17/iaf17 standard conditions Fig. 1 with image from Breuer et al., 2024
supraneural decreased thickness, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
whole organism htr2b expression decreased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 5 with image from Breuer et al., 2024
palatoquadrate cartilage ab1-col2a labeling decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
Meckel's cartilage sox9a expression decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
vertebra bone mineralization decreased rate, abnormal chd7iaf17/iaf17 standard conditions Fig. 1 with image from Breuer et al., 2024
basihyal cartilage sox9a expression absent, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
scale osteoblast activation quality, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
opercle bone mineralization decreased process quality, abnormal chd7iaf17/iaf17 standard conditions Fig. 1 with image from Breuer et al., 2024
osteoblast Ab3-runx2 labeling decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
Meckel's cartilage ab1-col2a labeling decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
Weberian apparatus decreased size, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
ceratohyal cartilage ab4-h3 labeling increased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
Weberian apparatus decreased thickness, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
tripus decreased thickness, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
precaudal vertebra increased volume, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
cranium decreased angle to trunk, abnormal chd7iaf17/iaf17 standard conditions Fig. 1 with image from Breuer et al., 2024
ceratohyal cartilage col2a1a expression decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal chd7iaf17/iaf17 standard conditions Fig. 1 with image from Breuer et al., 2024
ceratobranchial cartilage ab4-h3 labeling increased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
whole organism col2a1a expression decreased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
neural arch increased angle to centrum, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
head osteoblast activation quality, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
head osteoclast active, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
ventral mandibular arch increased angle to head, abnormal chd7iaf17/iaf17 standard conditions Fig. 1 with image from Breuer et al., 2024
ceratohyal cartilage cell population proliferation increased process quality, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
parapophysis decreased size, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
parapophysis decreased thickness, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
basihyal cartilage col2a1a expression absent, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
ceratobranchial cartilage ab1-col2a labeling decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
intercalarium decreased size, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
Meckel's cartilage ab4-h3 labeling increased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
whole organism postna expression decreased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
palatoquadrate cartilage decreased length, abnormal chd7iaf17/iaf17 standard conditions Fig. 1 with image from Breuer et al., 2024
whole organism sp7 expression decreased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
neural arch deformed, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
tripus decreased size, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
ceratobranchial cartilage cell population proliferation increased process quality, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
scale osteoclast active, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
supraneural decreased size, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
whole organism ctsk expression increased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
intercalarium decreased thickness, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
ceratohyal cartilage sox9a expression decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
precaudal vertebra bone mineralization decreased process quality, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
Meckel's cartilage cell population proliferation increased process quality, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
ceratobranchial cartilage sox9a expression absent, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
whole organism runx2a expression decreased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 3 with image from Breuer et al., 2024
Meckel's cartilage col2a1a expression decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
ceratohyal cartilage ab1-col2a labeling decreased distribution, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
ceratobranchial cartilage col2a1a expression absent, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
precaudal vertebra chondrocyte decreased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
vertebra increased volume, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
Weberian apparatus chondrocyte decreased amount, abnormal chd7iaf17/iaf17 standard conditions Fig. 4 with image from Breuer et al., 2024
vertebra increased mass density, abnormal chd7iaf17/iaf17 standard conditions Fig. 2 with image from Breuer et al., 2024
Citations