CRISPR

CRISPR3-esrp1

ID
ZDB-CRISPR-211103-1
Name
CRISPR3-esrp1
Previous Names
None
Target
Sequence
5' - GAAGCTGTCCATCCGTACAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
fb401 esrp1
Expression
Gene expression in Wild Types + CRISPR3-esrp1
No data available
Phenotype
Phenotype resulting from CRISPR3-esrp1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-esrp1
Phenotype Fish Conditions Figures
Meckel's cartilage transformed to ceratohyal cartilage, abnormal esrp1fb401/fb401 + MO1-esrp2 standard conditions Fig. 2 with imageFig. 3 with image from Caetano da Silva et al., 2024
neurocranium anterior region cleft, abnormal esrp1fb401/fb401 + MO1-esrp2 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
Meckel's cartilage morphology, abnormal esrp1fb401/fb401 + MO1-esrp2 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
pectoral fin curled, abnormal esrp1fb401/fb401; esrp2fb402/fb402 standard conditions Fig. 6 with image from Caetano da Silva et al., 2024
pectoral fin epithelial cell krt4 expression decreased amount, abnormal esrp1fb401/fb401; esrp2fb402/fb402 standard conditions Fig. 1 with image from Caetano da Silva et al., 2024
pectoral fin mesenchyme sox10 expression spatial pattern, abnormal esrp1fb401/fb401; esrp2fb402/fb402 standard conditions Fig. 1 with image from Caetano da Silva et al., 2024
Meckel's cartilage transformed to ceratohyal cartilage, abnormal esrp1fb401/fb401; esrp2fb402/fb402 standard conditions Fig. 1 with imageFig. 2 with imageFig. 6 with image from Caetano da Silva et al., 2024
ceratobranchial 5 tooth decreased amount, abnormal esrp1fb401/fb401; esrp2fb402/fb402 standard conditions Fig. 1 with image from Caetano da Silva et al., 2024
pectoral fin mesenchyme sox10 expression decreased amount, abnormal esrp1fb401/fb401; esrp2fb402/fb402 standard conditions Fig. 1 with image from Caetano da Silva et al., 2024
pectoral fin epithelial cell krt4 expression spatial pattern, abnormal esrp1fb401/fb401; esrp2fb402/fb402 standard conditions Fig. 1 with image from Caetano da Silva et al., 2024
otolith fused with otolith, abnormal esrp1fb401/fb401; esrp2fb402/fb402 standard conditions Fig. 1 with imageFig. 6 with image from Caetano da Silva et al., 2024
parasphenoid cleft, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
neurocranium cranial neural crest cell undifferentiated, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 8. with image from Carroll et al., 2020
neuromast absent, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
parasphenoid increased width, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
neurocranium epithelial cell mislocalised, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 8. with image from Carroll et al., 2020
Meckel's cartilage morphology, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
upper lip structurally discontinuous, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
keratinocyte morphology, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
neurocranium anterior region cleft, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 5. with image from Carroll et al., 2020
neurocranium chondrocyte absent, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 7. with image from Carroll et al., 2020
neurocranium cartilage element sox10 expression increased distribution, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 8. with image from Carroll et al., 2020
epithelial cell irf6 expression spatial pattern, abnormal esrp1fb401/fb401; esrp2fb402/fb402 (TU) standard conditions Fig. 8. with image from Carroll et al., 2020
neurocranium cranial neural crest cell undifferentiated, abnormal esrp1fb401/fb401; esrp2fb402/fb402; zf393Tg (TU) standard conditions Fig. 6. with image from Carroll et al., 2020
neurocranium chondrocyte absent, abnormal esrp1fb401/fb401; esrp2fb402/fb402; zf393Tg (TU) standard conditions Fig. 6. with image from Carroll et al., 2020
Citations