CRISPR

CRISPR1-sav1

ID

ZDB-CRISPR-210315-1

Name

CRISPR1-sav1

Previous Names

None

Target

sav1 (1)

Sequence

5' - GGATCTGTTGGAGATGTTAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mw95	sav1

Expression

Gene expression in Wild Types + CRISPR1-sav1

No data available

Phenotype

Phenotype resulting from CRISPR1-sav1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-sav1

Phenotype	Fish	Conditions	Figures
gall bladder morphology, abnormal	sav1^mw95/mw95	standard conditions	Fig. 1 , Fig. 2 , Fig. 11 from Brandt et al., 2020
gall bladder decreased size, abnormal	sav1^mw95/mw95	standard conditions	Fig. 1 , Fig. 2 from Brandt et al., 2020
intrahepatic bile duct morphology, abnormal	sav1^mw95/mw95	standard conditions	Fig. 1 , Fig. 2 , Fig. 5 from Brandt et al., 2020
bile canaliculus morphology, abnormal	sav1^mw95/mw95	standard conditions	Fig. 6 from Brandt et al., 2020
hepatocyte apical-basal polarity, abnormal	sav1^mw95/mw95	standard conditions	Fig. 7 from Brandt et al., 2020
gall bladder absent, abnormal	sav1^mw95/mw95	standard conditions	Fig. 1 , Fig. 2 , Fig. 5 from Brandt et al., 2020
whole organism dead, abnormal	sav1^mw95/mw95	standard conditions	text only from Brandt et al., 2020
intrahepatic bile duct increased diameter, abnormal	sav1^mw95/mw95	standard conditions	Fig. 2 from Brandt et al., 2020
whole organism viability, abnormal	sav1^mw95/mw95	standard conditions	text only from Brandt et al., 2020
gall bladder cell population proliferation increased occurrence, abnormal	sav1^mw95/mw95	standard conditions	Fig. 3 from Brandt et al., 2020
extrahepatic duct morphology, abnormal	sav1^mw95/mw95	standard conditions	Fig. 1 , Fig. 2 from Brandt et al., 2020
liver cell population proliferation increased occurrence, abnormal	sav1^mw95/mw95	standard conditions	Fig. 3 from Brandt et al., 2020
duct epithelial cell morphology, abnormal	sav1^mw95/mw95	standard conditions	Fig. 3 from Brandt et al., 2020
gall bladder morphology, abnormal	sav1^mw95/mw95; mw75Tg	standard conditions	Fig. 4 from Brandt et al., 2020
liver EGFP expression increased amount, abnormal	sav1^mw95/mw95; mw75Tg	standard conditions	Fig. 4 from Brandt et al., 2020
gall bladder EGFP expression increased amount, abnormal	sav1^mw95/mw95; mw75Tg	standard conditions	Fig. 4 from Brandt et al., 2020
whole organism decreased size, abnormal	sav1^mw95/mw95; mw97Tg	standard conditions	Fig. S6 from Brandt et al., 2020
intrahepatic bile duct morphology, ameliorated	sav1^mw95/mw95; mw97Tg	standard conditions	Fig. 5 from Brandt et al., 2020
liver dysplastic, abnormal	sav1^mw95/mw95; mw97Tg	standard conditions	Fig. S6 from Brandt et al., 2020
gall bladder present, ameliorated	sav1^mw95/mw95; mw97Tg	standard conditions	Fig. 5 from Brandt et al., 2020
gall bladder absent, abnormal	sav1^mw95/mw95; mw97Tg	standard conditions	Fig. 8 from Brandt et al., 2020
pronephric duct proximal region fibrotic, abnormal	stk3^mw96/mw96; sav1^mw95/mw95	standard conditions	Fig. 11 from Brandt et al., 2020
gall bladder morphology, abnormal	stk3^mw96/mw96; sav1^mw95/mw95	standard conditions	Fig. 11 from Brandt et al., 2020
pronephric duct proximal region dilated, abnormal	stk3^mw96/mw96; sav1^mw95/mw95	standard conditions	Fig. 11 from Brandt et al., 2020
gall bladder absent, abnormal	stk3^mw96/mw96; sav1^mw95/mw95	standard conditions	Fig. 11 from Brandt et al., 2020
whole organism dead, abnormal	stk3^mw96/mw96; sav1^mw95/mw95	standard conditions	text only from Brandt et al., 2020
whole organism viability, abnormal	stk3^mw96/mw96; sav1^mw95/mw95	standard conditions	text only from Brandt et al., 2020

Citations