CRISPR

CRISPR2-klf17

ID

ZDB-CRISPR-200323-2

Name

CRISPR2-klf17

Previous Names

None

Target

klf17 (1)

Sequence

5' - AGCACCGTGTATGACAGCGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uy21	klf17
uy22	klf17
uy23	klf17

Expression

Gene expression in Wild Types + CRISPR2-klf17

No data available

Phenotype

Phenotype resulting from CRISPR2-klf17

No data available

Phenotype of all Fish created by or utilizing CRISPR2-klf17

Phenotype	Fish	Conditions	Figures
posterior lateral line neuromast mislocalised posteriorly, abnormal	klf17^uy21/uy21	standard conditions	Figure 2 from Suzuki et al., 2019
posterior lateral line neuromast decreased amount, abnormal	klf17^uy21/uy21	standard conditions	Figure 2 from Suzuki et al., 2019
hatching gland he1.1 expression absent, abnormal	klf17^uy22/uy22	standard conditions	Figure 7 from Suzuki et al., 2019
posterior lateral line neuromast mislocalised posteriorly, abnormal	klf17^uy22/uy22	standard conditions	Figure 2 from Suzuki et al., 2019
posterior lateral line neuromast decreased amount, abnormal	klf17^uy22/uy22	standard conditions	Figure 2 from Suzuki et al., 2019
posterior lateral line neuromast mislocalised posteriorly, abnormal	klf17^uy23/uy23	standard conditions	Figure 2 from Suzuki et al., 2019
polster ctslb expression absent, abnormal	klf17^uy23/uy23	standard conditions	Figure 6 from Suzuki et al., 2019
polster cd63 expression absent, abnormal	klf17^uy23/uy23	standard conditions	Figure 6 from Suzuki et al., 2019
polster klf17 expression absent, abnormal	klf17^uy23/uy23	standard conditions	Figure 6 from Suzuki et al., 2019
posterior lateral line neuromast decreased amount, abnormal	klf17^uy23/uy23	standard conditions	Figure 2 from Suzuki et al., 2019
polster he1.1 expression absent, abnormal	klf17^uy23/uy23	standard conditions	Figure 6 from Suzuki et al., 2019
hatching gland cell absent, abnormal	klf17^uy21/+; klf17^uy22/+	standard conditions	Figure 4 from Suzuki et al., 2019
hatching non-progressive, abnormal	klf17^uy21/+; klf17^uy22/+	standard conditions	Figure 3 from Suzuki et al., 2019
hatching gland ctslb expression absent, abnormal	klf17^uy21/+; klf17^uy22/+	standard conditions	Figure 5 , Figure 7 from Suzuki et al., 2019
hatching gland klf17 expression absent, abnormal	klf17^uy21/+; klf17^uy22/+	standard conditions	Figure 7 from Suzuki et al., 2019
whole organism viability, abnormal	klf17^uy21/+; klf17^uy22/+	standard conditions	Figure 3 from Suzuki et al., 2019
hatching gland cd63 expression absent, abnormal	klf17^uy21/+; klf17^uy22/+	standard conditions	Figure 7 from Suzuki et al., 2019
hatching gland cell absent, abnormal	klf17^uy22/+; klf17^uy23/+	standard conditions	Figure 4 from Suzuki et al., 2019
hatching gland ctslb expression absent, abnormal	klf17^uy22/+; klf17^uy23/+	standard conditions	Figure 5 from Suzuki et al., 2019
nucleate erythrocyte nucleus increased size, abnormal	klf1^uy19/uy19; klf17^uy21/uy21	standard conditions	Figure 3 from Suzuki et al., 2023
whole organism slc25a37 expression decreased amount, abnormal	klf1^uy19/uy19; klf17^uy21/uy21	standard conditions	Figure 6 from Suzuki et al., 2023
whole organism slc4a1a expression decreased amount, abnormal	klf1^uy19/uy19; klf17^uy21/uy21	standard conditions	Figure 6 from Suzuki et al., 2023
erythroblast decreased amount, abnormal	klf1^uy19/uy19; klf17^uy21/uy21	standard conditions	Figure 1 from Suzuki et al., 2023
intermediate cell mass of mesoderm slc4a1a expression decreased distribution, abnormal	klf1^uy19/uy19; klf17^uy21/uy21	standard conditions	Figure 5 from Suzuki et al., 2023
intermediate cell mass of mesoderm alas2 expression decreased distribution, abnormal	klf1^uy19/uy19; klf17^uy21/uy21	standard conditions	Figure 5 from Suzuki et al., 2023
whole organism alas2 expression decreased amount, abnormal	klf1^uy19/uy19; klf17^uy21/uy21	standard conditions	Figure 6 from Suzuki et al., 2023
intermediate cell mass of mesoderm slc25a37 expression decreased distribution, abnormal	klf1^uy19/uy19; klf17^uy21/uy21	standard conditions	Figure 5 from Suzuki et al., 2023
yolk erythroid progenitor cell decreased amount, abnormal	klf1^uy19/uy19; klf17^uy21/uy21; ko05Tg	standard conditions	Figure 3 from Suzuki et al., 2023

Citations