CRISPR

CRISPR2-hmx3a

ID

ZDB-CRISPR-191111-1

Name

CRISPR2-hmx3a

Previous Names

None

Target

hmx3a (1)

Sequence

5' - GGCGTTTAAGTTCCCATTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
su3	hmx3a

Expression

Gene expression in Wild Types + CRISPR2-hmx3a

No data available

Phenotype

Phenotype resulting from CRISPR2-hmx3a

No data available

Phenotype of all Fish created by or utilizing CRISPR2-hmx3a

Phenotype	Fish	Conditions	Figures
inner ear hmx3a expression decreased amount, abnormal	hmx3a^su3/su3	standard conditions	Figure 5 from England et al., 2020
neuroblast (sensu Vertebrata) hmx3a expression decreased amount, abnormal	hmx3a^su3/su3	standard conditions	Figure 5 from England et al., 2020
anterior macula fused with posterior macula, abnormal	hmx3a^su3/su3	standard conditions	Figure 5 from England et al., 2020
spinal cord glutamatergic neuron decreased amount, abnormal	hmx3a^su3/su3	standard conditions	Figure 5 from England et al., 2020
inner ear anterior region pax5 expression decreased amount, abnormal	hmx3a^su3/su3	standard conditions	Figure 5 from England et al., 2020
spinal cord GABAergic neuron gad1b expression increased amount, abnormal	hmx3a^su3/su3	standard conditions	Figure 6 from England et al., 2020
neuromast primordium migration disrupted, abnormal	hmx3a^su3/su3	standard conditions	Figure 4 , Figure 5 from England et al., 2020
spinal cord inhibitory interneuron slc32a1 expression increased amount, abnormal	hmx3a^su3/su3	standard conditions	Figure 6 from England et al., 2020
spinal cord GABAergic neuron increased amount, abnormal	hmx3a^su3/su3	standard conditions	Figure 6 from England et al., 2020
spinal cord inhibitory interneuron increased amount, abnormal	hmx3a^su3/su3	standard conditions	Figure 6 from England et al., 2020
otolith fused with otolith, abnormal	hmx3a^su3/su3	standard conditions	Figure 4 , Figure 5 from England et al., 2020
otic vesicle anterior region pax5 expression decreased amount, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019
otic vesicle anterior region hmx3a expression decreased amount, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019
lapillus fused with sagitta, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019
inner ear morphogenesis decreased process quality, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019
otic vesicle anterior region hmx2 expression decreased amount, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019
posterior macula fused with anterior macula, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019
otic vesicle anterior region fgf3 expression decreased amount, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019
otic vesicle postero-medial region hmx3a expression mislocalised, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019
statoacoustic (VIII) ganglion neuroblast hmx3a expression decreased amount, abnormal	hmx3a^su3/su3 (AB)	standard conditions	Fig 5 from Hartwell et al., 2019

Citations