CRISPR

CRISPR2-hmx3a

ID
ZDB-CRISPR-191111-1
Name
CRISPR2-hmx3a
Previous Names
None
Target
Sequence
5' - GGCGTTTAAGTTCCCATTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
su3 hmx3a
Expression
Gene expression in Wild Types + CRISPR2-hmx3a
No data available
Phenotype
Phenotype resulting from CRISPR2-hmx3a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-hmx3a
Citations