ZFIN ID: ZDB-ALT-170830-2
Genomic Feature: su3
Synonyms:
Affected Genomic Regions: hmx3a (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR2-hmx3a
Lab Of Origin: Lewis Lab - Syracuse
Location: Chr 17: 21792075 - 21792078 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 73 bp inserted / 4 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
CAGCGGCTGGCTTACAGGAACGTTGCCCGCTGTGTTGGTGCTCTCAGAGGCCGAGTTCTCGTGATACAGGATGGGTACTCTCACAATCCTTTGTGCTGCTGCGTGGCTCAAGTTGGCGGCCTCCAGCTCTGCGGCCAGCTGACGTTTCCATTTGTTTCTGCGGTTCTGAAACCAGATTTTCACTTGAGTCTCTGTGAGGTGAAGGGAGGCAGCAAGGCCCGCGCGCTCCGAGCTGCTGAGGTAGCGTTTCATGTCGAAGGTGGACTCCAGCTGGAACACCTGACTCCGCGAGAACACCGTGCGAGTTTTCTTTTTCCGGCAAGGTTTCTTGTCAGCGCCGTCGTCACTCTTCTTCCAGTCGTCTATGCCGCCTTCTTTTTTACCGTCTTCGGTGTCGCTCTCCTCGAGGACAATCTCGTCGCCACTTTTGTTGTCGTCTTCATCGTCCTTGGCGTCCGGATCTGATTTGAGCACAAGCTCGGGGGAATCTCGGTCGGTGC
CTGT/GGACTCTTCGCCGACCACAGGTCATGGCGTTTAAACCTTAATTAAGCTGTTGTAGGCACCGACCGAGATTCCC
GGTCGGCGAAGAGTCCCTCGCTTTCTGTGCTGCTACAGTAATAGAGGCCAAATTAGCATTCGTTTTCTTTCAGAAACATATTCATATCAAGTTTCACTGGTCGTGTCACTTTGCCACATGACAGGTGCAAACAATTGTGATTCGCACTGTCCAAAATCTCAGTGTTTTTAAAACTTCAACCCTGCATTTTAAACTAAAAACATGCGAGCTTTCATATTTAAAGAATGATAACAGCTGCTGTTATGTTTGATACTTAGCCTATATTATTTATAATCTGTCGGGAAACAAGCTATAGGCTGGCTTGCTACAGTGCATGCTTATGCACCAATATTTTATATCAGAATCACGCTATTAATTATCATAAATAATAAATCAGCGCAGATTACTCAACAAAGCAGTTATGAGATAATAAATCTTACCTTCTGTTCTGTGAAGATGCGCGGATGCACTGAGTGTGTACGGGTACCACCACGCCGAGGCACGCTCAAGGTAAGCCGGTA
Comment Citation
The SU3 allele of hmx3a was generated using a CRISPR sgRNA targeting exon 2  ... Hartwell et al., 2019
OTHER su3 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous hmx3asu3/su3 hmx3a ♀+/- ♂+/-
hmx3asu3/su3 (AB) hmx3a ♀+/- ♂+/-

CITATIONS  (2)