CRISPR

CRISPR1-kif3a

ID
ZDB-CRISPR-180328-1
Name
CRISPR1-kif3a
Previous Names
None
Target
Sequence
5' - GAGGAGGTGAGAGATCTGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
Genomic Features
Genomic Feature Affected Genomic Regions
ouc2004 kif3a
Expression
Gene expression in Wild Types + CRISPR1-kif3a
No data available
Phenotype
Phenotype resulting from CRISPR1-kif3a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-kif3a
Phenotype Fish Conditions Figures
retinal cone cell decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 2 from Feng et al., 2017
photoreceptor cell cilium absent, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 3 from Feng et al., 2017
retinal rod cell gngt1 expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 1 from Feng et al., 2017
retinal rod cell rho expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 1 from Feng et al., 2017
long double cone cell cell body decreased length, abnormal kif3aouc2004/ouc2004 standard conditions Fig. S4 from Zhu et al., 2021
whole organism rho expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 1,  Fig. 7 from Feng et al., 2017
whole organism gnat2 expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 2 from Feng et al., 2017
short double cone cell cell body decreased length, abnormal kif3aouc2004/ouc2004 standard conditions Fig. S4 from Zhu et al., 2021
whole organism opn1sw1 expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 2 from Feng et al., 2017
retinal cone cell degenerate, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 2,  Fig. 3 from Feng et al., 2017
retinal rod cell pde6gb expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 1 from Feng et al., 2017
long double cone cell decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. S4 from Zhu et al., 2021
whole organism gnat1 expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 1,  Fig. 7 from Feng et al., 2017
whole organism grk1b expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 2 from Feng et al., 2017
short double cone cell decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. S4 from Zhu et al., 2021
inner ear cilium absent, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 3 from Feng et al., 2017
eye photoreceptor cell photoreceptor connecting cilium absence of anatomical entity, abnormal kif3aouc2004/ouc2004 standard conditions Figure 4 with image from Zhu et al., 2021
photoreceptor cell membrane irregularly shaped, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 2 from Feng et al., 2017
whole organism pde6c expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 2 from Feng et al., 2017
whole organism pde6a expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 1,  Fig. 7 from Feng et al., 2017
whole organism pde6gb expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 1,  Fig. 7 from Feng et al., 2017
whole organism gngt1 expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 1,  Fig. 7 from Feng et al., 2017
whole organism grk7a expression decreased amount, abnormal kif3aouc2004/ouc2004 standard conditions Fig. 2 from Feng et al., 2017
eye photoreceptor cell photoreceptor connecting cilium Ab15-tuba labeling absent, abnormal kif3aouc2004/ouc2004 standard conditions Figure 4 with image from Zhu et al., 2021
retinal rod cell amount, ameliorated kif3aouc2004/ouc2004; fl1Tg chemical treatment: 2-aminoethoxydiphenylborane Fig. 8 from Feng et al., 2017
retinal rod cell decreased amount, abnormal kif3aouc2004/ouc2004; fl1Tg standard conditions Fig. 1,  Fig. 7,  Fig. 8 from Feng et al., 2017
retinal rod cell degenerate, abnormal kif3aouc2004/ouc2004; fl1Tg standard conditions Fig. 1,  Fig. 7,  Fig. 8 from Feng et al., 2017
retinal rod cell degenerate, ameliorated kif3aouc2004/ouc2004; fl1Tg chemical treatment: 2-aminoethoxydiphenylborane Fig. 8 from Feng et al., 2017
retina EGFP expression decreased amount, abnormal kif3aouc2004/ouc2004; fl1Tg standard conditions Fig. 1 from Feng et al., 2017
retinal rod cell degenerate, ameliorated kif3aouc2004/ouc2004; fl1Tg chemical treatment: dantrolene Fig. 8 from Feng et al., 2017
retinal rod cell degenerate, exacerbated kif3aouc2004/ouc2004; fl1Tg chemical treatment: thapsigargin Fig. 8 from Feng et al., 2017
retinal rod cell amount, ameliorated kif3aouc2004/ouc2004; fl1Tg chemical treatment: dantrolene Fig. 8 from Feng et al., 2017
retinal rod cell decreased amount, exacerbated kif3aouc2004/ouc2004; fl1Tg chemical treatment: thapsigargin Fig. 8 from Feng et al., 2017
retinal rod cell degenerate, ameliorated kif3aouc2004/ouc2004; fl1Tg; ouc2001Tg heat shock Fig. 7 from Feng et al., 2017
photoreceptor cell apical region EGFP expression mislocalised, abnormal kif3aouc2004/ouc2004; fl1Tg; ouc2001Tg heat shock Fig. 7 from Feng et al., 2017
retinal rod cell amount, ameliorated kif3aouc2004/ouc2004; fl1Tg; ouc2001Tg heat shock Fig. 7 from Feng et al., 2017
photoreceptor cell apical region GFP expression mislocalised, abnormal kif3aouc2004/ouc2004; ouc2001Tg heat shock Fig. 2 from Feng et al., 2017
photoreceptor cell photoreceptor outer segment GFP expression decreased amount, abnormal kif3aouc2004/ouc2004; ouc2001Tg heat shock Fig. 2 from Feng et al., 2017
whole organism pde6gb expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/+ standard conditions Fig. 7 from Feng et al., 2017
whole organism pde6a expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/+ standard conditions Fig. 7 from Feng et al., 2017
whole organism gngt1 expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/+ standard conditions Fig. 7 from Feng et al., 2017
whole organism gnat1 expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/+ standard conditions Fig. 7 from Feng et al., 2017
whole organism rho expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/+ standard conditions Fig. 7 from Feng et al., 2017
whole organism gngt1 expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/ouc2003 standard conditions Fig. 7 from Feng et al., 2017
whole organism pde6a expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/ouc2003 standard conditions Fig. 7 from Feng et al., 2017
whole organism gnat1 expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/ouc2003 standard conditions Fig. 7 from Feng et al., 2017
whole organism rho expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/ouc2003 standard conditions Fig. 7 from Feng et al., 2017
whole organism pde6gb expression amount, ameliorated kif3aouc2004/ouc2004; rhoouc2003/ouc2003 standard conditions Fig. 7 from Feng et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.