229 results
ZDB-GENE-090807-3
| Gene Name: | transcription factor EB |
|---|---|
| Location: | 11 Mapping Details/Browsers |
Matching Text:
| Abbreviation | tfeb |
| Gene | tfeb |
| Related Gene Symbol | tfeb |
| Orthologue | TFEB......Tfeb |
ZDB-TSCRIPT-141209-3326
| Transcript Name: | tfeb-201 |
|---|---|
| Previous Names: | tfeb-001 |
| Location: | 11 Mapping Details/Browsers |
Matching Text:
| Abbreviation | tfeb-201 |
| Gene | tfeb |
| Marker Abbrev | tfeb-201 |
| Related Gene Symbol | tfeb...tfeb |
ZDB-TSCRIPT-141209-883
| Transcript Name: | tfeb-202 |
|---|---|
| Previous Names: | tfeb-002 |
| Location: | 11 Mapping Details/Browsers |
Matching Text:
| Abbreviation | tfeb-202 |
| Gene | tfeb |
| Marker Abbrev | tfeb-202 |
| Related Gene Symbol | tfeb...tfeb |
ZDB-TSCRIPT-141209-2107
| Transcript Name: | tfeb-203 |
|---|---|
| Previous Names: | tfeb-003 |
| Location: | 11 Mapping Details/Browsers |
Matching Text:
| Abbreviation | tfeb-203 |
| Gene | tfeb |
| Marker Abbrev | tfeb-203 |
| Related Gene Symbol | tfeb...tfeb |
ZDB-TSCRIPT-240503-1875
| Transcript Name: | tfeb-204 |
|---|
Matching Text:
| Abbreviation | tfeb-204 |
| Gene | tfeb |
| Marker Abbrev | tfeb-204 |
| Related Gene Symbol | tfeb...tfeb |
ZDB-TSCRIPT-240503-1876
| Transcript Name: | tfeb-205 |
|---|
Matching Text:
| Abbreviation | tfeb-205 |
| Gene | tfeb |
| Marker Abbrev | tfeb-205 |
| Related Gene Symbol | tfeb...tfeb |
DOID:0081414
| Synonyms: | Renal Cell Carcinoma with t(6;11);(p21;q12); MALAT1-TFEB, Renal Cell Carcinoma with t(6;11);(p21;q12); MALAT1::TFEB, t(6;11) Renal Cell Carcinoma, t(6;11);(p21;q12) Renal Cell Carcinoma |
|---|---|
| Definition: | A renal cell carcinoma with MiT translocations that is characterized by the presence of the chromosomal translocation t(6;11) which fuses the TFEB transcription factor gene, located on chromosome 6, with the MALAT1 gene, located on chromosome 11. |
Matching Text:
| Abbreviation | TFEB-rearranged renal cell carcinoma |
| Alias | Renal Cell Carcinoma with t(6;11);(p21;q12); MALAT1-TFEB...Renal Cell Carcinoma with t(6;11);(p21;q12); MALAT1::TFEB |
| Definition | A renal cell carcinoma with MiT translocations that is characterized by the presence of the chromosomal translocation t(6;11) which fuses the TFEB transcription factor gene, located on chromosome 6, with the MALAT1 gene, located on chromosome 11. |
ZDB-ATB-190219-4
| Synonyms: | TFEB Antibody, A303-673A |
|---|---|
| Host Organism: | Rabbit |
| Type: | polyclonal [IgG] |
| Sources: | Bethyl Laboratories, Inc. |
Matching Text:
| Abbreviation | Ab1-tfeb |
| Marker Abbrev | Ab1-tfeb |
| Alias | TFEB Antibody, A303-673A |
ZDB-ATB-200708-4
| Synonyms: | Rabbit Polyclonal| Catalog number: 13372-1-AP |
|---|---|
| Host Organism: | Rabbit |
| Type: | polyclonal [IgG] |
| Sources: | Proteintech |
Matching Text:
| Abbreviation | Ab2-tfeb |
| Marker Abbrev | Ab2-tfeb |
ZDB-CRISPR-171206-3
| Type: | CRISPR |
|---|---|
| Targets: | tfeb |
| Sequence: | TGACCAGCAACTCCTGCCCT |
Matching Text:
| Abbreviation | CRISPR1-tfeb |
| Target | tfeb |
| Marker Abbrev | CRISPR1-tfeb |
| Related Gene Symbol | tfeb |
ZDB-CRISPR-190219-1
| Type: | CRISPR |
|---|---|
| Targets: | tfeb |
| Sequence: | GGTGCACTGATGGCTGGCGT |
Matching Text:
| Abbreviation | CRISPR2-tfeb |
| Target | tfeb |
| Marker Abbrev | CRISPR2-tfeb |
| Related Gene Symbol | tfeb |
ZDB-TGCONSTRCT-220325-1
| Synonyms: | Tg(cmlc2:tfeb-egfp) |
|---|
Matching Text:
| Abbreviation | Tg(myl7:tfeb-EGFP) |
| Related Gene Symbol | ...tfeb |
| Alias | Tg(cmlc2:tfeb-egfp) |
| Coding Sequence | ...tfeb |
ZDB-ALT-220325-4
| Synonyms: | |
|---|---|
| Type: | Transgenic insertion |
| Construct: | Tg(myl7:tfeb-EGFP) |
Matching Text:
| Related Gene Symbol | ...tfeb |
| Alias | ...Tg(myl7:tfeb-EGFP)...Tg(cmlc2:tfeb-egfp) |
| Coding Sequence | ...tfeb |
ZDB-ALT-200423-1
| Synonyms: | nei08Tg |
|---|---|
| Type: | Transgenic insertion |
| Construct: | Tg(actc1b:tfeb-ZsGreen1) |
Matching Text:
| Related Gene Symbol | ...tfeb |
| Alias | ...Tg(actc1b:tfeb-ZsGreen1)...Tg(actc1b:tfeb-ZsGreen) |
| Coding Sequence | ...tfeb |
ZDB-TGCONSTRCT-200423-1
| Synonyms: | Tg(actc1b:tfeb-ZsGreen) |
|---|
Matching Text:
| Abbreviation | Tg(actc1b:tfeb-ZsGreen1) |
| Related Gene Symbol | ...tfeb |
| Alias | Tg(actc1b:tfeb-ZsGreen) |
| Coding Sequence | ...tfeb |
ZDB-ALT-171206-5
| Synonyms: | |
|---|---|
| Affected Genomic Regions: | tfeb |
| Type: | Allele with one deletion |
Matching Text:
| Affected Gene | tfeb |
| Related Gene Symbol | tfeb |
ZDB-ALT-131217-12847
| Synonyms: | |
|---|---|
| Affected Genomic Regions: | tfeb |
| Type: | Allele with one point mutation |
| Consequence: | Splice Site |
| Sources: |
Matching Text:
| Affected Gene | tfeb |
| Related Gene Symbol | tfeb |
ZDB-ALT-161003-16254
| Synonyms: | |
|---|---|
| Affected Genomic Regions: | tfeb |
| Type: | Allele with one point mutation |
| Consequence: | Premature Stop |
| Sources: |
Matching Text:
| Affected Gene | tfeb |
| Related Gene Symbol | tfeb |
ZDB-ALT-190219-1
| Synonyms: | 5 bp deletion |
|---|---|
| Affected Genomic Regions: | tfeb |
| Type: | Allele with one deletion |
| Consequence: | Frameshift, Premature Stop |
Matching Text:
| Affected Gene | tfeb |
| Related Gene Symbol | tfeb |
| Note | st120 contains a 5 bp deletion which results in a change in reading frame after amino acid 45 and a premature stop codon after amino acid 61, compared to 491 amino acids for wild-type Tfeb protein. |
ZDB-ALT-190219-2
| Synonyms: | 8 bp deletion |
|---|---|
| Affected Genomic Regions: | tfeb |
| Type: | Allele with one deletion |
| Consequence: | Frameshift, Premature Stop |
Matching Text:
| Affected Gene | tfeb |
| Related Gene Symbol | tfeb |
| Note | st121 contains a 8 bp deletion which results in a change in reading frame after amino acid 46 and a premature stop codon after amino acid 60, compared to 491 amino acids for wild-type Tfeb protein. |