Morpholino

MO1-desi2

ID
ZDB-MRPHLNO-080912-1
Name
MO1-desi2
Previous Names
  • MO1-fam152a
  • MO1-pppde1
  • ZPnas4-MO (1)
Target
Sequence
5' - CAGGATAACCGGCTCGTTTGCCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-desi2
No data available
Phenotype
Phenotype resulting from MO1-desi2
Phenotype Fish Figures
axis decreased length, abnormal TU + MO1-desi2 Fig. 3,  Fig. 5 from Yao et al., 2008
axis increased width, abnormal TU + MO1-desi2 Fig. 3 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO1-desi2 Fig. 5 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO1-desi2 Fig. 3,  Fig. 5 from Yao et al., 2008
neural plate increased width, abnormal TU + MO1-desi2 Fig. 5 from Yao et al., 2008
polster mislocalised, abnormal TU + MO1-desi2 Fig. 5 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO1-desi2 Fig. 3 from Yao et al., 2008
post-vent region curved ventral, abnormal TU + MO1-desi2 Fig. 3 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO1-desi2 Fig. 3 from Yao et al., 2008
prechordal plate mislocalised, abnormal TU + MO1-desi2 Fig. 3,  Fig. 5 from Yao et al., 2008
Phenotype of all Fish created by or utilizing MO1-desi2
Phenotype Fish Conditions Figures
prechordal plate mislocalised, abnormal TU + MO1-desi2 standard conditions Fig. 3,  Fig. 5 from Yao et al., 2008
post-vent region curved ventral, abnormal TU + MO1-desi2 standard conditions Fig. 3 from Yao et al., 2008
polster mislocalised, abnormal TU + MO1-desi2 standard conditions Fig. 5 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO1-desi2 standard conditions Fig. 3 from Yao et al., 2008
axis increased width, abnormal TU + MO1-desi2 standard conditions Fig. 3 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO1-desi2 standard conditions Fig. 5 from Yao et al., 2008
axis decreased length, abnormal TU + MO1-desi2 standard conditions Fig. 3,  Fig. 5 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO1-desi2 standard conditions Fig. 3 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO1-desi2 standard conditions Fig. 3,  Fig. 5 from Yao et al., 2008
neural plate increased width, abnormal TU + MO1-desi2 standard conditions Fig. 5 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
notochord increased width, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
axis decreased length, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in axis elongation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.