TALEN

TALEN1-socs1a

ID
ZDB-TALEN-150721-1
Name
TALEN1-socs1a
Previous Names
None
Target
Target Sequence 1
5' - ATAGAAGATCGCCAAGTGAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Target Sequence 2
5' - ATCTTTGGGATTGGAAGACGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb29 socs1a
ihb33 socs1a
Expression
Gene expression in Wild Types + TALEN1-socs1a
No data available
Phenotype
Phenotype resulting from TALEN1-socs1a
No data available
Phenotype of all Fish created by or utilizing TALEN1-socs1a
Phenotype Fish Conditions Figures
female organism has extra parts of type liver lipid droplet, abnormal socs1aihb29/ihb29 (AB) standard conditions text only from Dai et al., 2015
male organism has extra parts of type liver lipid droplet, abnormal socs1aihb29/ihb29 (AB) standard conditions text only from Dai et al., 2015
liver gck expression decreased amount, abnormal socs1aihb29/ihb29 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver ins expression increased amount, abnormal socs1aihb29/ihb29 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver hif1al expression increased amount, abnormal socs1aihb29/ihb29 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver pck1 expression increased amount, abnormal socs1aihb29/ihb29 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver foxo1a expression increased amount, abnormal socs1aihb29/ihb29 (AB) standard conditions Fig. 5 from Dai et al., 2015
female organism has extra parts of type liver lipid droplet, abnormal socs1aihb33/ihb33 (AB) standard conditions text only from Dai et al., 2015
liver ab11-akt labeling increased amount, abnormal socs1aihb33/ihb33 (AB) control Fig. 5 from Dai et al., 2015
whole organism il6 expression decreased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 2 from Dai et al., 2015
male organism has extra parts of type liver lipid droplet, abnormal socs1aihb33/ihb33 (AB) standard conditions text only from Dai et al., 2015
liver g6pc1a.1 expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver ldlra expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver ab5-akt labeling decreased amount, abnormal socs1aihb33/ihb33 (AB) control Fig. 5 from Dai et al., 2015
liver lipid droplet increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 4,  Fig. 5 from Dai et al., 2015
whole organism ab1-hbbe1 labeling increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 2 from Dai et al., 2015
liver scd expression decreased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
whole organism il1b expression decreased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 2 from Dai et al., 2015
whole organism ab3-stat5 labeling increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 2 from Dai et al., 2015
liver regulation of tyrosine phosphorylation of STAT protein disrupted, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism tnfa expression decreased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 2 from Dai et al., 2015
liver ab3-stat5 labeling increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism ab1-hbbe1 labeling amount, ameliorated socs1aihb33/ihb33 (AB) chemical treatment: tyrphostin B42 Fig. 2 from Dai et al., 2015
liver gck expression decreased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
subcutaneous fat decreased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 4 from Dai et al., 2015
liver cellular response to insulin stimulus decreased process quality, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver ins expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
whole organism ab3-stat5 labeling amount, ameliorated socs1aihb33/ihb33 (AB) chemical treatment: tyrphostin B42 Fig. 2 from Dai et al., 2015
whole organism morbidity, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 3 from Dai et al., 2015
blood plasma response to insulin decreased process quality, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver cellular response to glucagon stimulus decreased process quality, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver insrb expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
whole organism ifng1 expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 2 from Dai et al., 2015
whole organism decreased size, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 3 from Dai et al., 2015
regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction disrupted, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver apoa4a expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
whole organism decreased weight, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 3 from Dai et al., 2015
lateral plate mesoderm gata1a expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 2 from Dai et al., 2015
liver hif1al expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver pck1 expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver foxo1a expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
blood plasma ins expression increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
protein phosphorylation disrupted, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
liver hkdc1 expression decreased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 5 from Dai et al., 2015
nucleate erythrocyte increased amount, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 2 from Dai et al., 2015
whole organism growth decreased rate, abnormal socs1aihb33/ihb33 (AB) standard conditions Fig. 3 from Dai et al., 2015
whole organism increased weight, abnormal socs1aihb29/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism growth increased rate, abnormal socs1aihb29/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism increased length, abnormal socs1aihb29/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism increased size, abnormal socs1aihb29/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism increased weight, abnormal socs1aihb33/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
liver ab3-stat5 labeling increased amount, abnormal socs1aihb33/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
liver regulation of tyrosine phosphorylation of STAT protein disrupted, abnormal socs1aihb33/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism growth increased rate, abnormal socs1aihb33/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism increased length, abnormal socs1aihb33/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
whole organism increased size, abnormal socs1aihb33/+ (AB) standard conditions Fig. 6 from Dai et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.