Morpholino

MO1-ahi1

ID
ZDB-MRPHLNO-120314-2
Name
MO1-ahi1
Previous Names
  • SPL8MO (1)
Target
Sequence
5' - CCACACTCTGAAAGGGAAAAACATT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ahi1
Expressed Gene Anatomy Figures
ahi1 Fig. 3 from Simms et al., 2012
Phenotype
Phenotype resulting from MO1-ahi1
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-ahi1 Fig. 3 from Elsayed et al., 2015
Fig. 3 from Simms et al., 2012
camera-type eye morphogenesis decreased process quality, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
eye decreased size, abnormal AB + MO1-ahi1 Figure 4 with image from Zhu et al., 2019
eye malformed, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
heart bilateral symmetry, abnormal twu34Tg + MO1-ahi1 Fig. 5 from Simms et al., 2012
heart edematous, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
heart looping decreased process quality, abnormal twu34Tg + MO1-ahi1 Fig. 5 from Simms et al., 2012
inner ear has fewer parts of type otolith, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
inner ear morphogenesis decreased process quality, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
kidney morphogenesis decreased process quality, abnormal zf106Tg + MO1-ahi1 Fig. 6 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 Fig. 4 from Simms et al., 2012
otic vesicle morphology, abnormal AB/TU + MO1-ahi1 Fig. 3 from Elsayed et al., 2015
post-vent region curled, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
pronephric duct lacks parts or has fewer parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 Fig. 6 from Simms et al., 2012
pronephros cystic, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
pronephros dilated, abnormal WT + MO1-ahi1 Fig. 3 from Simms et al., 2012
retinal ganglion cell axon decreased length, abnormal AB + MO1-ahi1 Figure 4 with image from Zhu et al., 2019
retinal ganglion cell axon extension process quality, abnormal AB + MO1-ahi1 Figure 4 with image from Zhu et al., 2019
retinal ganglion cell axon guidance disrupted, abnormal AB + MO1-ahi1 Figure 4 with image from Zhu et al., 2019
whole organism anatomical axis curved, abnormal AB/TU + MO1-ahi1 Fig. 3 from Elsayed et al., 2015
Phenotype of all Fish created by or utilizing MO1-ahi1
Phenotype Fish Conditions Figures
retinal ganglion cell axon guidance disrupted, abnormal AB + MO1-ahi1 standard conditions Figure 4 with image from Zhu et al., 2019
retinal ganglion cell axon extension process quality, abnormal AB + MO1-ahi1 standard conditions Figure 4 with image from Zhu et al., 2019
eye decreased size, abnormal AB + MO1-ahi1 standard conditions Figure 4 with image from Zhu et al., 2019
retinal ganglion cell axon decreased length, abnormal AB + MO1-ahi1 standard conditions Figure 4 with image from Zhu et al., 2019
whole organism anatomical axis curved, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
brain hydrocephalic, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
otic vesicle morphology, abnormal AB/TU + MO1-ahi1 standard conditions Fig. 3 from Elsayed et al., 2015
camera-type eye morphogenesis decreased process quality, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
eye malformed, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
heart edematous, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
pronephros cystic, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
pronephros dilated, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
inner ear has fewer parts of type otolith, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
post-vent region curled, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
brain hydrocephalic, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
inner ear morphogenesis decreased process quality, abnormal WT + MO1-ahi1 standard conditions Fig. 3 from Simms et al., 2012
heart bilateral symmetry, abnormal twu34Tg + MO1-ahi1 standard conditions Fig. 5 from Simms et al., 2012
heart looping decreased process quality, abnormal twu34Tg + MO1-ahi1 standard conditions Fig. 5 from Simms et al., 2012
pronephric duct lacks parts or has fewer parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 6 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
kidney morphogenesis decreased process quality, abnormal zf106Tg + MO1-ahi1 standard conditions Fig. 6 from Simms et al., 2012
motile cilium assembly decreased process quality, abnormal slc24a5b1/b1 + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
Kupffer's vesicle lacks all parts of type ciliated epithelial cell cilium, abnormal slc24a5b1/b1 + MO1-ahi1 standard conditions Fig. 4 from Simms et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.