Morpholino

MO6-pax6b

ID

ZDB-MRPHLNO-100610-5

Name

MO6-pax6b

Previous Names

Target

Sequence

5' - AAAGTTGTGATCGTTCACCTTTCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO6-pax6b

Expressed Gene	Anatomy	Figures
gcga	pancreatic A cell	Fig. 6 from Verbruggen et al., 2010
ghrl	endocrine pancreas peptide hormone secreting cell	Fig. 6 from Verbruggen et al., 2010
ins	pancreatic B cell	Fig. 5, Fig. 6 from Verbruggen et al., 2010
sst2	D cell	Fig. 6 from Verbruggen et al., 2010

Phenotype

Phenotype resulting from MO6-pax6b

Phenotype	Fish	Figures
D cell decreased amount, abnormal	AB + MO6-pax6b	Fig. 6 from Verbruggen et al., 2010
endocrine pancreas peptide hormone secreting cell increased amount, abnormal	AB + MO6-pax6b	Fig. 6 from Verbruggen et al., 2010
lens decreased size, abnormal	AB + MO6-pax6b	Fig. 5 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye disrupted, abnormal	AB + MO6-pax6b	Fig. 5 from Verbruggen et al., 2010
pancreatic B cell decreased amount, abnormal	AB + MO6-pax6b	Fig. 5, Fig. 6 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal	AB + MO6-pax6b	Fig. 5 from Verbruggen et al., 2010

Phenotype of all Fish created by or utilizing MO6-pax6b

Phenotype	Fish	Conditions	Figures
lens morphogenesis in camera-type eye disrupted, abnormal	AB + MO6-pax6b	standard conditions	Fig. 5 from Verbruggen et al., 2010
endocrine pancreas peptide hormone secreting cell increased amount, abnormal	AB + MO6-pax6b	standard conditions	Fig. 6 from Verbruggen et al., 2010
D cell decreased amount, abnormal	AB + MO6-pax6b	standard conditions	Fig. 6 from Verbruggen et al., 2010
lens decreased size, abnormal	AB + MO6-pax6b	standard conditions	Fig. 5 from Verbruggen et al., 2010
pancreatic B cell decreased amount, abnormal	AB + MO6-pax6b	standard conditions	Fig. 5, Fig. 6 from Verbruggen et al., 2010
type B pancreatic cell differentiation disrupted, abnormal	AB + MO6-pax6b	standard conditions	Fig. 5 from Verbruggen et al., 2010
lens morphogenesis in camera-type eye disrupted, abnormal	AB + MO6-pax6b + MO7-pax6b	standard conditions	Fig. 5 from Verbruggen et al., 2010
lens decreased size, abnormal	AB + MO6-pax6b + MO7-pax6b	standard conditions	Fig. 5 from Verbruggen et al., 2010

Citations