Genomic Feature

szu2

ID
ZDB-ALT-210706-1
Name
szu2
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
Lab of Origin
Tokumoto Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 13: 29771465 - 29771470 (GRCz11) (1) Details
Nucleotide change
GGATAT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
6 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
ACAGGCACATCCCATTCTTGAAGAGAGGGGGACTGAGAGACACTCGCCGTGTCCATGTTTTTTCCTGTCATTCCCGCACGAATCTGACTGTACCCCTCAGACTGTTCAGACCAGAAACGCTTCTCCACATCGAGGAATTTACACTGCAGTTTCACCAGAGGACACTGGAGCAGACGCAACCACTAATGCTTGCGGTCCCTTAAATATGTAGCTAACAAATTTTTACTCAACGACTGATTACGCTAACGTTCCTGCGTGAAAGATTTTTGAGAGACCAGTGCAGGACATGATCTGCACCTGACCAGCCTCGTGTCTTCGTTGAATGGACTGATCAGCACGAGATAAAGTTCGTCGCGCGTTGAACAACTTCTTCTGTACACTGGCATTGGAAGCACCGGGCTTTGAACGGATAGCGATCTTTATTAATTTCAATTATAGCTACATAATCAAGGCGAGACGGCGACCTCAGTCGATTATCTTTCCTTCCTTTGCTATCCCAT
GGATAT/- TCACTGCAAAGCAGACCCCTTCTCGGCGATGCACCGTAAGTAAAATAACAGTTTTTTTTCTTCTTAACAAATCTGTAATTTAGCATAAATAAAATATATATATTGTTTAGCTTTTACGTTGAGCTGGCTTTGTAAAACCATAGGCTTACATGTGCGCGTTATTTTTTTCAAAGGTCTTACAAGAAATTTATTAATGATTGTTTTAATAATTTATTTACATAGTACGGTAAAATACGGAAAGTACTCAGCTTAAAAATACACGTGTCCGCTGGTTACATTTCACAGCAATTTAGCCGTTTATGAAAAAAGTAGTTGAGAAAGTCAATTATTATATACAGCGTAATATTAGTTTAATTTAATTTACAATTCTCAATTTTATGTAAAACATCAGTGATTCGCGCGCATTTCATGAGCAACAACATAAGTCATATTTTTAAACTATCATGTTTGGATAAATGACTACTGCCTACATGGGTAAAAATAGATTTAGCTACTGAAAA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations