Genomic Feature

pt527

ID
ZDB-ALT-201015-9
Name
pt527
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Beth Roman Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 5: 21211266 - 21211273 (GRCz11) (1) Details
Nucleotide change
CACTGCTC/-
Variant Notes
c.132_139del
p.Thr45Argfs*4 (premature stop codon within the prodomain at  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GAGAGAGAAAGTAGAGAGCAAGAGTGAGAGAGAAAGAGAGAGAGAGGAAAAAACATTTGAAAAGAGATGGCACAGAGGGACATCTCTTTCACGTACTGAAACCACCCTCAAACTTTTCAGACATCAAAAGGTGAGAAGAAGAATAAATGCTCAGAGTTCAGGAATAGAGGCACTTTATTGCAGGCATCAGTGTGAGGCTACATATTGAACCAGAACAGCAAGGACAAGTCTACTATCTTAAGTTTTGCAGTGGAGCGTCAACTAAACTTCTGTCCAGGAAAAGTTGTGTACTGAAATTAAGTGCTTTTGATAGTGGATCTATAGATCTCACCTCCTGCACCTATAGCTAATACACATTTGTCTTGCGTCATGGCTGGTAGCAGAAATCACTTTTGGATTATATTTTCATCTGCCACGTCTGCTTTATTGGCCTTTTTCCTGCTTTTCTGGGGGCCTTTCTGTGTGCAAAGTAGCCCCATCAGCTCCCCGGAGAGGCACCG
CACTGCTC/- CAGGGTTGGATGATGGACATGGAGGCGTTTTGGATCCTTCACTCTTGGAGCAGGACAGTGAGGCGAACATGCAGAGCTTGATGGAGACCCTGAAGGGACAGTTTCTGCAGACTTTCAATCTGACCCGTCCCAGCTCTCCTGCGCATCAAGGGGCCACTCGTGTAGAGCCACCTGAGTATATGCTGGAACTCTACAACCGATTCGCCAATGACCGAACAGCAATGCCTTCGGCAAACATCATACGCAGCTTTAAAAATGAAGGTAACTGCATATTTTCCTATTCAATGAGGGCATTATAATCATTTGTATCGTAGGAATTTGTTATTTTTTTGTAAAAGAAAAAAAGAAAAAAACAACAACTTATTTTTCGACTGTTTATGTGATAAATAATGGTTTCCAAAATAATAATAATAAATGTAACGGTAACACTTTATTTTGATAGTCCATTTGAGTATTAGTAGACTGTCTGCTTAACATTCAACAGATATTTAACTGACTAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations