Genomic Feature

zf3090

ID
ZDB-ALT-200709-10
Name
zf3090
Synonyms
  • ctgfa MRE mutant sensor (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Nicoli Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 20: 25343428 - 25343441 (GRCz11) (1) Details
Nucleotide change
GACCAAAATGTTAC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
14 bp deleted (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CCCTCCTCTAAACTGTGGTGAGCAGATTCAGATTCTGAGAGCAAAAATAGTAAGAAATGGATGGCAGCTTTAACCCCAGAAGCTAATCGCCTCACCAAGCTAAGAAGGCGGAAAAAAGAGACAGAGAGAAATTGATGTGCTCTTATGTTTAGTTGATATTGTCAGCTCAGAGTTTGATTGAGCTGATCCAAGACATGAAGTTTGGCCAAGAACTATGAAGGTTAATATAGCACTGAGTGTTTGACTGTCTGGCCCCTCCTGTTGGGAAAGAGCCAGTATCCCTGTCAAAAAGACTGGATGAATTGTAGCTTCATTCTTTTTTATGACAATATCTATTTTTGAAAGCTGTAAATAATGTACATATTTTGTACAGCTTAAGTTAATTTAAATTGAAAGCATTTTGTCTTCTTATTTCCTTGCTTCGTCATGTTTAATGATAGCTTCATGTGCTGACTTGACTATTCTTGGTACAGCTTGTCCAATATTTTATTGAGAAGTGT
GACCAAAATGTTAC/- ATGTTTTCACTTTTGTAGTTTACAATAAAATATTATATTTTTATACAAACATTGCCATACTTGGAGTCGTTTTTACCCTCATACTGAAAACAAAGCAACTTCATACAGTACATCTGATATCAACCACACAATAATGGCACCATGTTTTTACAAAAGCCTCATGTTCACACTTCAATGGCATTTTTACATCCCCAGTGTGGACCACACAGCTGAGTTGTGTGCGGTCCATCAAGCTCAAGACCACACACATGGTCCTCCTGACACATGCACATTCAGAACATATACAACGATAATGTAAGAGCTGGAATAAGTGCATACTTGACAGTCTCATTTGGTGAAAATATTGATACATTAATGATATACATATCATTAAAATGTTTTTGAATGTGATGCCTATGCTCACCTGTGCTGACTCAAAACAGAATAACTTTGTGAAAAATGTTGCAATTCAACAATTCAATTCGAATACAACTCATATTTTCTAAAATGCAACATGTAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations