Genomic Feature

nt30

ID
ZDB-ALT-200206-16
Name
nt30
Synonyms
  • terminus, trm (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Wingert Lab
Current Source
Other Pages
Note
Transcript analysis revealed four aberrant tfap2a spliceoforms compared with wild-type embryos. One aberrant transcript encoded an in-frame addition of 38 amino acids, which may possess native function or have dysfunctions associated with protein folding or stability. The other three transcripts encoded premature stop codons. These aberrant transcripts are predicted to truncate the essential transcriptional activation and DNA-binding domains in Tfap2a.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 24: 8729222 (GRCz11) (1) Details
Nucleotide change
C/T
Variant Notes
Transcript analysis revealed four aberrant tfap2a spliceoforms compared with  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A at position 495 in Donor Splice Site of Exon 1 (1)
Transcript Consequence
Splicing Variant, Premature Stop (1)
Protein Consequence
Amino Acid Insertion: 38 AA added (1)
Sequences
Flanking Sequence
ATTTTATTAGTAGGCATATTATTATTATTATTATTATTATTATTATTATTATTATTATTAATGACAGTAATAATAATAATAATAATAATAATAAGACCTTAATATAACCAGAAGTGATATGTTATGGCTCGAAGGGCGCTAGCCTAATTTTCATTTCAGCAGGAAAGCGAACAACCATTTGATTTGTGGGAGAACAATACTAACAAGAATAATAAATATAGCCTAACAAAAACATTCTAATTATTAATATTTACACTATCATACTTAAAATGTACGTCAAATGTTTGGTTTTCGTTTACCAGTTAAAATCCTACCGAAAGGCAAAGGAAATTAACAATTAACCACAGCTCACATGAAGAAAATCTTTGTAATAGCCTTTGATACTACCATGAACGACTTGCATGATGGAACAGAGTAAACGACAGGATGAAACAACAACAACAATCGGAAGTAGGCTAAATGTTGAGTGCAGAAAGATCTGTACTCCCGACATTCACTCA
C/T CATCGCGGAAAAACTGTGCACTAACATCTGTGAAGATTCCCGAGGACTTCAAAAGACGTGAAATTCAGAAGGACAAATCAAAAACGAACGTGCAAATTAAATCAAGCCAACAATAATTGTAGGGCGAGGTGGCGGTGGCCAGCGTTCAAATAAAGCAATAATCCATCAGAATCTGGGTAAATTCCCACTGTTCTTCGTCTGCCCTTTAGATGCAATGCTTTTCTCTAAAGTTTCTTAGATCCCCTTGGCGTCTCCCGGCTCTGTCAGTAAGCTGTTCCCTCGCTTGAGCTCATGTTAGCACAAATGTGCCTCTTCCTCTGCACTCCTAATAGTAGATATTCATGACTATTAATATTACACGAATACTTAATAAGAGAAGAATGGTCGGAAATCGAGCGTGAAGCGAGGAAGCAACTCAAGGCAGACTGCACTAAATGACGTCCATTGAATGAGGAATCAGTATATCTAATCAGATGAGGAGAGAGGGAGTGAGTGGGAGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations