ZFIN ID: ZDB-ALT-200129-2
Genomic Feature: a216
Synonyms:
Affected Genomic Regions: elfn1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR2-elfn1aCRISPR1-elfn1aCRISPR3-elfn1aCRISPR4-elfn1a
Lab Of Origin: Schier Lab
Location: Chr 3: 42547993 - 42548515 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE (GENOMIC)
TCCATTCTTAGGCCCAGTAGATAGTGTCAGGCAAGTATGATTGAATCGCAATGAGTTTCTTATTGAAGCCACACAGTAGGTGTAATCAGTGTGGGGTTTCAGGTTTTTTAGTTCAATGTCCTCTTTCTGTCGCTTCAGATTCTGTATATCAGTGAAGAAGCTGTTGTTGTACAACACAAGGATGTACATTTTCTTGTAGGGGTAAGGGATCTGAACAGTGATTACTGCGTTCGTGTGAGACACTTGTTTGAGTTTCATGATTGGTTTCACATCTAAATCTAGGAACGTGGGACTTATGCTGATTTCCTCCGGCTCAGTACCTGAGGGACAGTCTTCAAGCCCACATGGTGTGGAGTCCGGAGGGAAAGTGGTGGTATCAGGAGGCACAGATATATACGGAGTCACATAATCCTCCGTGCACACAGTGGACAGCATATGCAGAGCATTCCGGTATGTGGGATTGGTCGGATTCTGGCTTAGAAGACTGTAGCCTGAGACCC
CTGCAGGAGAGTCACATACCATCCGCTCACTTGTCCGGTTGGGAAAGACAGACAGCCACTTTACAAACCCCAAGAGCTCACAGGAGCAGTTGAAAGGGTTTGTGTAGAGTTCACAGGTGGTCAACTTAGTCAGGCTGGTGAAGGTAGACCCATCTAACACCTGGAGGCGGTTCATAGAAAGGTCAATGTTTTCAATGTTTGGGCACTCCCAAAAGGCATTGGGTGTCACAGTCTCAATCAGGTTGGCCTGGAGGTAGAGGTACTGCAGCTTGCCCAATCCCCTGAGAATCCCTTCAGTCAAGTTACGCATCTTATTGAAGCCTAACTGGAGAACCTGCAAATTAAACTGGGCCGAAAAAGCTCCATCCTCGATGTAATTAATCTCATTCTTGGTCAGATTCAGGTATGTGAGGTTGGTAAAGCGGCTGAGGGCAGAGTAGTGGATACTCTTGATCTTGTTCTCATTCAAGCGAAGGTCCACTATGGTGCTGTTGATATGCTGAGGGATGGCCTCATAGGGTGG/-
CTGATTTTGGCTGCATATGGCCAACCATACAAAGCCCTTTTCACCTTCTATGAGCCAGCAGTCTCCCTTCACTCCACCCA  ...
OTHER a216 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous elfn1aa216/a216 elfn1a ♀+/- ♂+/-

CITATIONS  (1)