ZFIN ID: ZDB-ALT-190911-7
Genomic Feature: mk19
Synonyms:
Affected Genomic Regions: zbtb24 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-zbtb24
Lab Of Origin: Goll Lab
Location: Chr 17: 6949866 - 6949873 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted (1)
Protein Consequence: at position 82 (1)
FLANKING SEQUENCE (GENOMIC)
ACACCTCAAAATGACCCTTGCGCCAAGCTAAAAGTACCAAAAGACTATTGCGCCGCACCTTGCGCCACTTTGCTCCGGGTGTATGATAGGGCCCTTACTCTATTGCTGTTCAATTCTGCAGTGTCTCTCTCCACAAATCTCCTGTGTTTTGACCTGTGGTTTCTGGTCATCTATAATCCTAACTCGACATTGCACATCTTGTGATGTGACTATTGCGGACACACATTGATGCTCAAACAATACATTTTGCAGTAACCTATACCTGCATGTGTTCATCAACAGCTTGCAGGTCCTCATGGGCTTTGATCAGATCTGGGATGACCAGAAATCTGGCCATTTCCATCAGCTGCTCAGAGCTGCTCTCGTCCACCAACACGACTGCGCTGTACATGAACTCCAGCACGGAGGAGAAGGTGTTCGCCGTCATGCCGTCCAGCTTGTAGAGCGACTGGCTGACCTGTTCTTCAGCGGTGAACAATGCTGAGAAATATTCACTGCTC
GCTGCTAG/-
GAGAGCCTTGTGCGCCTTGAAGTGCACATCTTCCACGATCAGGGTAATGTCGCAGAGCAGTTCACTTCTCCTGAGCGTGTCAAACTTGTGCAGGATTGTGTCCTTGTGTGTTGCTGAGTGCAGAGCGAGGACTGCTGGTGATGATGATGATGATGATGATGGAGGAAGGGCAGACATGATGACCTTACTCGCACACTGAACCTGAAACAAAACACACACACCCATCTGTTAAAGGCTAACAAAGTTTTATTTATTGATCTATTTAGTTGGTTGATTAAGTTTCATATTCATAAGAGTAAATTTTCCAACAAAAACCCTTTTACTCTGTTTTAAAAGGAGCTGAAAAATTACTTTTGGATAATTTAACAGTACTTGGACCATTAAAATGGAACATTTGTATCCTATTGGCATTATACACTCATTGGCCACTTTATTAGGTACTCTTGTCCAACTGCTTGTTAAAGCAAATTTCTAATCCACCAATCAAATGGCAGCAACTT
OTHER mk19 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous zbtb24mk19/mk19 zbtb24 ♀+/- ♂+/-

CITATIONS  (1)