ZFIN ID: ZDB-ALT-190816-4
Genomic Feature: uab203
Synonyms:
Affected Genomic Regions: fkrp (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-fkrp
Lab Of Origin: Alexander Lab
Location: Chr 15: 11681481 - 11681493 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 13 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
CCAGCTCCCGAATGAGACGCTCAACTTGTCGACCATGGTCCAGCTCCACACCATCAGGAACTAACAAAGAAAACTCTGTCTGCACGTTGAACTCGGGACGGTGAGTTTGTGGAGGCTGGTCAGGACTTGGGGACATCACCAGCAGCCGTGCTCCCTCTGGAAGAGCCAAAGGAGGGTACGGTGAATTTTCAGCAACTGCGAGGAAGGGTAATTCTGGTCTCTGCCGCAGAAAGGAGCGTGCAACATCACCAACATAGTTTTCAAAATCTTCAAATTCCCGAACCAGGATCGTGACGCGTGGACCACGCATGTTTCCCTCAAGACCTCCTAATTTAACACCTCCAACCATGCTTCCACCAACGAGGTTACCCATCGCTCCTAGGCCTGACACAGGAAGAGAGGCTTTCTTTAAGCCTTTACCTTGCTCTCGACGCTTCTCCATCATTTGCTGCTGAGCCCGCGAGACATAATACAAGATGAGCAAGTTTAAAATGATTGCT
CTCTGTTAACTGG/-
CCTGGCAAAAACTGATACGCATTATGGCTCTTGTGGTTTTATGGCAGAAAGAGTAAATGAAATCTCAGATTATTCTGAATGTCATAACATGTCCAAATTAGTGAAAACCTCAACATTAACATCCTAGTCTGGCCAAAAGTGATGCTGAAAGTGGACAGTGTTTGAGGTGAATATTTGATGAAGCATCTTTGACTTGATCAGTTTCCACTCATGTCTTCCTCTCTGTCAGCTGATCCCATTCAGGAAAAAAGACTGATGGACTGACTCCATTATCAACCAGATTGGCTTTAGTTCTCCATAGTCCGTTAATTAAATGCTATAGGCTACATGGAGAAAAACAAAACAACATTTTAATAAACAACTTCTCTTTCCAAAGCACAAGGTTATTGTACAGTTTAAGCTTGTACTACAAAATCCCCATTAGCCACCACTTTTAATTCTACCAACAAACGTGACCTAGAAATTTACGTTAGGCTATAGAGATGCTCAAATGCTGCTGT
OTHER uab203 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous fkrpuab203/uab203 fkrp ♀+/- ♂+/-
fkrpuab203/uab203 (AB) fkrp ♀+/- ♂+/-
Complex fkrpuab203/uab203 ; uab202Tg fkrp
twu3Tg ; la116Tg ; fkrpuab203/uab203 fkrp

CITATIONS  (1)