Genomic Feature

bns301

ID
ZDB-ALT-190813-9
Name
bns301
Synonyms
  • vegfaa5′UTRΔ10 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 16: 4317386 - 4317395 (GRCz11) (1) Details
Nucleotide change
GGGTGCTATA/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp deleted in Exon 1 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TGTCAAAGCAGACAGCGCAACAGAAGGACCATCTCTGATTTAAGTGAAAACTTATGGTTAATATCCACATTATGAGTAACATGTTGTGCAATAGGAAGGCTTTAAAGGTCATCCATAGATGACAATAAAAAGATACAAGCTTGCTTTCTATTATAAGTAACATTAGGCTAATCGTTTTGAAACAAAGTAAGTAAATGTAAACTTTATGTAACTTATTGTAGCATATAAATGGTGTGGGCTATTGCATTTCGTCTTTAAGACGATCTCACGTTACACATTAATAATAAACAACCCCAATGCACATGAATTTCTCTCATTTCATACTGACCCCCTGAACCCTTACCTTTACAGCAGACAGATGGAGGAGAGCCGCGAGAAATAACTGTATCAAATAAACAACCAAGTTCATGATTGTAATTCCAGTGGAGTGTTGCGGTGAGTCTCTGGCTCTCAAAACAATTAAGAAAGCGAAGCTGCTGGGTATGAATGAACCGAGTGTG
GGGTGCTATA/- TCAAAGTAACACATCCATTCTGCCCTTCAGATCCGAAGCACCTGCGTCGAATCCGCTAAAATTAACTTCTGGACCGCCACCCGCTCCTCCAGAGAAAAAAAAAGGATATAAATAAGAATAACAATAATAATTATAATATAAAGAAAAGTGGAAATCCACACTATCTTGGTCCTCTGCGTAATTTAAAATTAAAATCCACAGTATAACGGAAAGCCGACGTTTAATGAATCTGAATCCAAAACGTCAGAGGCAAAACAAACAAAAAGTTTCGTCCACTTCCAAGCGCAGCCTCCAGTGTGCACGCGCGTCTATAGGGCCAGAGGACGGCTTCTGCGCATATGATTATCATCAAGAGCAAAGGCTTGCTGTAAAGTGATCCAGTGGCAATCCTTGGTTTGACCGCTGCACACGCGTCCGTTTTTTCCTCGTCTTATTTCCGTGACTGTTTTGGCTCGCGCTGGTTCGTACTGCCGTGGATGTTAACACGCGTACGGGAAGGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations