Genomic Feature

bns292

ID
ZDB-ALT-190403-10
Name
bns292
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 11: 34780268 - 34780275 (GRCz11) (1) Details
Nucleotide change
TTGAACTG/-
Variant Notes
p. Gln67Gly*9
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted in Exon 3 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CAGAAGATACAAACCAGGATGATTCAAATGAAGTCTAATGTTTCACAGAGCCAAGCGCAGACTCACCTGCCACTCATTTAGATCCCGAACCTCATTTTTAGGTCTCTCAAGTGCACGTTAATGTCACATTTTAATCACAAAACCTGACGTTTAAGAGCTTCCTGCATCTGTTTGCTTCACAGATTCTGGGGCATTGTTACATATGATCTCTTCATAGTCAAAAGTGGAGCTGTCTTTGCTGTGAGGGGGTGAAGTGAGGATAACATTAGCTAGTCGCTGGGTTTTCTGTGGCTGCTGCTGCTGTGGAATCAGTAGAGGATGCTGGGAGAGAGTCAGTGGGTGCAGTATTTGCTTCACCAGAGGGGGCACTGTCGTTGTCGTCTTCCTGAGGGTAAAGCTCAGGGTATTTCTGCATACACTCCTGCATACCCCGGAAGTTTTCCACACAATCGGAGCCCTTTATCTCCTCTTTGCTATAGTGGAAACATGAAAACGCATCC
TTGAACTG/- CTGTCCACAAGGGCCACTGGCCATGCCGCCCAAACACGGGCAGTTCCAGTTTATGTCGCCATTAGGTAGAATAAGACCTGTGGGATCATAGCAAACGGGTATTGTGGAGATCAATTATAGAAGAGATTTAAATGATGCTAGCTGATATGGCTGCACGATACTGGGAAAAGATCCCATGTTGTTGAGTATTACGAATTTTTGATAACTGTATATAAAGATAGAAAAACCCCATGTTTGATTGTATAGATAATCAACCTATTACACAAAAAAATTGGTATATAAATAAATGTAATTTATCTAGTGCTGCGCAGAGTTGTAGTGATTAACTGCATCCAAAAAAAAAAGTTTGTTTTGGCATAATGTGTGTTTAAATTACTTTCAAGGCCAAAATGACTCCTACCCCAGGGGTAAGAATTTTCTTGGGCTTGGCATGCACGCATACATGCGCGCGCACGCATGCACACATGCACACACACACACACACACACACACACACACAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations