Genomic Feature

ihb310

ID
ZDB-ALT-181126-5
Name
ihb310
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 13: 25600552 - 25600559 (GRCz11) (1) Details
Nucleotide change
GATACACT/A
Variant Notes
8bp deletion, 1bp insertion. 79bp to 87 bp of the wild-type ret exon 4 coding  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp inserted / 8 bp deleted in Exon 4 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GGAAAAACATTTTTAAAAGCACTAAAATTATGTTTAAAAATAAGCAAAAAACTGTTTTTGTACTCACTGTATTCATGAACAGTCCCACGGACATTTCCAAAAATAGCTTTCTCTTCCCTAAACTTGTGTTCAATAGCAAAATTATTTTTGATCCAGGAGTCATTTGTCATCAGGGTCCCCACCAGTTTATTTTGAACTTGGTTTGTGGGATAAACTGGTGTTGTGTCTCTGTCATATACAAACAGAGTCCCAAACACAGTACCCTACAAAAGAGAAAAGCTTATTAATATACAAGATCAAAAAAGCTAAGAAGATTACACACACACACACACACAAAATAGCACACACCTCACTGCGGTCAAACTCTACTAAGACGTCTTCAGTGTCAGTCCCGTTGACATAAGGAGAATTATCATCTTCATCATAGATGTTCACATGTAAAGATCTGAAGACCTCCTCCAGATTTCTTTCTGTTCGTACCATACAGACTATATCCAGAT
GATACACT/A TCCTTCTCCTCGCGGTCCACTTGTGCTGTGACCACTAGTTCAGAAGTGGAGTCGTCGACCGCAAACGGTACAGAAGATCCTGAATTAAATATAAACAAGCACAGACAATCCATCTTAGAGTAGTGACGGGAGAAAATAAGTTTTCCAAATCTTTAAATGACTTAGACCAATTGCTTCATATAATGATTTTGAAGTGTTCAAATGATCACAGACTGAGTAACTCTGCTGGTCAAATCTGTGCAAATACAACAAAAACCCATGTCAAAAATGTATCAAAAACAGCTTTTACAAACACATTTAGCAAAGATTTATTGACTATAATTGATCAAATGCATTTAGCTAACCATCTAACATCATTAAATATACAACAAATCAGCATAATGTGCCTTCTTTTATCAATTTACAATACTTATTTTGTTTGTTGCATGGTGAGCTCTGCTAAACAGCCCAATGTGAAACTATTTTCTACCATTAAATGATTATTTCAGCCAAAAATTACT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations