Genomic Feature

s722

ID
ZDB-ALT-181008-5
Name
s722
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Stainier Lab
Current Source
Other Pages
Note
this in-frame deletion which removes three amino acids (R149 to A151) from the homeodomain,
There is a SNP in the wild type sequence presented in this article.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 12: 47667574 - 47667582 (GRCz11) (1) Details
Nucleotide change
AGGCTGGCG/-
Variant Notes
this in-frame deletion which removes three amino acids (R149 to A151) from the  ...
There is a SNP in the wild type sequence presented in this article.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
9 bp deleted (1)
Transcript Consequence
Inframe Deletion (1)
Protein Consequence
None
Sequences
Flanking Sequence
TGTGTGTGTCCTTCTCACTAAAGTGTGTGTCTCTCACTGATGTTTATGTCTCCCTCACTAACTTGGGTGTGTGTGTCTCACACACTGATGTGTGCCAGTCCCTCTCGGTGTGTCTGTCTGTCTCTTACTAATGTGTGTGTGTGTGTGTGTCTGTCTGTCTGACTCTCTCTTACTAATGTGTGTCTATCTCGCTGATGTTTGTGTTTCTCCCTCACTAATGTGTGTGTGTGTGTGTGTCTCTATAATGTGTGTGTGTGTGTGTGTGTGTGTCTCACTGATGTGTTTGTGTGTGTGTGTCTTACTAAGTTGTGTGTGTGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGATTCTCCAACGATCAAACCATCGAGCTGGAGAAGAAGTTCGAGACGCAGAAATATCTGTCTCCGCCCGAGAGGAAG
AGGCTGGCG/- AAGATGCTGCAGCTCAGCGAGAGACAGGTGAGAGCCACAGCACAGCATTCAGCCTTAAAACATCATTCAGACAAAAAATTATCTCACGAATCACATCTGCTTCTGTCTGCAGGTCAAAACATGGTTCCAGAACCGCCGGGCGAAATGGAGGCGCCTGAAGCAGGTGAGAATCGCGTCTTATTTACCGTCTAGTTCGGTAATGTTCATTTGTGTCAAACATGCTTCAGTGAACCAATTTTAAATATTTAATTTTTAATTAATTAGTCAAACAAGTTTACAGTTTTTTTTATTATTTAAGGGGAAATGTCTGTCAACAGTTTCAGTATTGTGTGTTTTTCAAGTGTTTTCTGTTTATTTACAGTTGTGAATTGCATTATGGGATGTTGATCTCTGCTCTGTCGATTTTTAATGTAGAAAATTAAAGTCTACAGTTTAACAAAGTGACTTTTATTGACAATTTAATAGTTTAAAATATGATGTAGGCTTTAAGAAACAATAGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations