Genomic Feature

zf1089

ID
ZDB-ALT-180905-2
Name
zf1089
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one insertion (1)
Protocol
embryos treated with zinc finger nuclease
Lab of Origin
Zhdanova Lab
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Insertion
Variant Location
Chr 16: 252391 - 252392 (GRCz11) (1) Details
Nucleotide change
-/GCAG
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp inserted in Exon 12 (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
None
Sequences
Flanking Sequence
TCCAGCATTACTAGCTCTTGTTTTAAAGTTAAAACTCTTCACTTTTGAGATGTGTGATGGTCAACACAGCTAGATCTAAATGACAATATAGAGGGAAAGTTGAATATCAAATTACAGCCTAAAGTTATGAAATAAAATGAAAAATACATACATTTAATGACAACAGTCAACATAATAATGCGGATTTTGATAATGTCCTTTGTTTGTTTATTTGTGCTACTTTAACGATCATCACACCTTCAGTAATGTTGCATGCTCTTGTTTTTGAGGTTGTAATATTGTTTCAGCTCAATGTGGATCAATATCTCTCACTGTGGAGTGTTGTGGTGCTGAACAGAGAGAGAACACTGTAATGATGGAGACGAGTGGTTGGTCACACTGTCTGAAAACACATCAGTCTCTAACGCAGCATCAGCTTGCAGGAGAAAATGCTGCAGCTCACCGTAAAACCAGGCGATGCCGATGGCCTCAATTAGTACTCCAAAGAGAATTGACGTCCCC
-/GCAG GCAGCGAAGTGGTCCAACAGCGTAAACACATAGATTCCACCCTACAAAGAGAGCAGCAGAGTAAACACGTAGATACCACCCTACAGAGAGAGCAACAGAGAGATGAAGACACAGTGATTAACCCTACGATGAACATTTCCCCAAGTGCATTTAATGGAGATATGTTTAAACAAAATGCTCTAGTAACACATCTATTTACTTTCTCTTCGCCATGATGACAGTACATTATATTTTACTAGGTATTTTGCAAGGTGCCATTATTCAGCTTAAAGTGACATTTAAAGGCTTCACTAGGATAATTCGGCAAGTCACTGCAGTGCCTTGTTTTGTAGACATTCATAAATTCATTCATTTTCCTTTGGCTTAGTCTCTATTTCTGACGTTGCCACAGTGGAATGAACCACTAATTATTCTAGCATATGTTTTACACAGCAGATGTCCTTACAGCTGCAATCCAGTACTGGGAAAGACCCATACACACTCATGCACAACGGCCAGTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations