ZFIN ID: ZDB-ALT-180813-3
Genomic Feature: t614A
Synonyms:
Affected Genomic Regions: alkal2a (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR1-alkal2a
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 23: 35547344 - 35547356 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 35 bp inserted / 13 bp deleted from position 1978 to 1990 in Exon 2 (1)
FLANKING SEQUENCE (GENOMIC)
TTTGTGCATATACATTTGATTAGTCAGTACTGAACCAAATCTGGTGATAACGGTCCAAAAACTAGTAAAGCCAAATATACAGTATATTTTATAGAAAAATATTAAATACAAATAAAAAAAAGACTAAATCAACAGAAGCACAACAATTAAAAGATTTAGTTGAAATTTTGTAGGTTGTCATTTTTTTGTGCAATATTTAGCTTAAATTTAATTGTATTAAATTTCTGAATATGTTTGGTGACTAAAATGTTATTTTAATAAATATATCTGTTTAATAAATCTGTTTTGTTTAAATGCACCAAAATACATTGCCTCTATTCACTGAGAAATAGATAAAAAAAATCTTGATTTTCAAAATGGGGTGTACTCTGTTATGCTGAGCACTGTACTTATTAGACAACATTTTGCTTGAAAATTCAGTTTGGGTCATCCCACATTCTAATATATAGTTCACTGACATTTTGTGCATCTTTAAATGCCCTGCTTACCTAAAATTGTTT
CTCCACTTGCCGT/TTTAGGTAAGTTTTTTAGGTAAGCAAAAAAAATT
TTTGAGATGGTGCGTGTCCTTCGGCTCAGGCGCGCTCTCTGTCTTCTGCGCGCTCTCGTCGTCAGCGCTATTTTCCACCTGTCTCATGATTTCCATGATCCGTCTGAGCGTTTTCTCCACTTTGTTCGCGCTGGCATCGCTTTGTGCGGCAGTGCAGATTAACAATACGAGCCCCATTACCAGCACCGGGGCTCGCAGCGCGCGCATCTCTCCCGAAACCAGAGTGCGCGCACAGCCCAAGTCCAGGATCACGCAGTCTGGAGAAGAAGTGGCAGGGTTTATATGATAAACTTTTATGTTGGAAATGAGCTTTGGAAGCTTTTGCGATTTATTTAAAATAGAAGTCTTGCTCGATTTTCACTAGATTGGACACACCTACTCTTTCTTTTTATTGTCATTTTTGGTATAGCATCAGAACTGTGGCACTTGTGATTCGAATTTAAGACAAATCCAAAACTGTCTCTGGATTTTATTCATTGAGTGCCTCCTATCATGGGTTT
OTHER t614A PAGES No links to external sites

CITATIONS  (1)