ZFIN ID: ZDB-ALT-180813-2
Genomic Feature: t613A
Synonyms:
Affected Genomic Regions: alkal1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-alkal1
Lab Of Origin: Nüsslein-Volhard Lab
Location: Chr 8: 18464523 - 18464527 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 5 bp deleted from position 1629 to 1633 in RefSeq:XM_003199060 in Exon 3 (1)
FLANKING SEQUENCE (GENOMIC)
ACAATGCGCAATGGTTAGATTTAGGTCAAATCAAGGATGTGTTTATTTAAAACATTTAAAATTTGTATTTGTTTATTTTATATTTGGATATTATGCATTTATATAGTGTAGATATGTCGTGACTTGTACAAAAATCTGCCTATAATAACGCAGGACCACTGCGCAAATTTTGCCAAGTGCGCATTTACGCGCGTATCAACTTTTACTAGGCTATGCGACGATTTAATGACTTGCTTTCCTGTTTTGTTCGTTTGTCAGTCTGGAAAGCCATGCGGGCTGAGAAGAGATGGCACATCTTGTTGAGTATGATTCTTTTGCTCATCACCTCCAGCCAGTGCATGGACAGCAAGGAGGTAAAGGAGTCGGAAAGGAAAACTCTGCTTAATCTAATCCTGCAAGTGATCGGGGAAAAGCCCGCGTCCAGACGCGTCACCAGTGGCCTCTACTCTGTATCTCAAGATGCTAAGTTTTCCTCGCGTGAAAACACTGCACATTTGCCC
AAGCC/-
GGACAACAGCAGACCAATAGGTAAGCTGATTTGAGATCAGGTGATAAATGTAATCCAGGGCATTAACTCCTTCCTGTTTCTGCATATCAAATGCACTTTTAACACCTAATCGCTGACAGCTCGTCATATTTTGTGTTGATGAATTGCAGTGACATTAACATAACCTGTAATAATTGGCTCAATGTTAAAAGTCCAGTTTAAAAAAAAAGCTGTGAAATTGGATTAAGGAACACTCTTTTGATCTACAGAGGGTGGTAAAATGAATGCTTATGGTCTTGTTAGGCAGATAACATAACGCTGAAATCACCAGCGTAGATCTAAGAACTGCTCAGAGAAAGTTTATAAGCTTGGGAAATCATGGAGCTAATTGTCACATGTAATGGTGTGCGCCTTTAGAAAACTGCTGGTGAGCTGCTGCATTTCACAAAAAAAAAAAAAAAAAAAGTGTGTGTGCCTGAAAATGTGCTTCATGCATAACTCTGAAACTATTTGGGTTGTTT
OTHER t613A PAGES No links to external sites

CITATIONS  (1)