Genomic Feature

ihb395

ID
ZDB-ALT-180523-3
Name
ihb395
Synonyms
  • stat5.2 delta5 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Gui Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 12: 13622029 - 13622033 (GRCz11) (1) Details
Nucleotide change
GGATT/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
5 bp deleted (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CCGTCTATTAAAGAGCTAAAATATTACAGCTTACATCATGTTTTGTGTCCAATTGCTTAGTTTTGTGACATTTAACTGTGTAATAAGGACCCAGATGGCAGCGGAATAAAGCACTTTTGTATCATACAAATGGCAAGCTTTCTATGATGCATTGTTTTTAACGCTGTTAAGAAAATCAATGGACATGTAGTTTCTGCAATTTTTTAGGTCTGAAAACCACATGTAGATGAAGCATTTACTTTCAGATTTGCAATGTCTAATATATGGATAACCATAATAACGAAGGGAACAAAATTATGTGTTATGTGACATTCATATTATCTTGTAAATCTGTCTTTGCACATCTTGTGATGGTTTTGTTGGGAAGCCTTGCTTGCATATTACATCCCTTTTATTTTGATCTTAGAACAGAGTCTGCATAGAGACACTCACCATGGTTGAGCCTCCAGCCATTGTGCCAAGTAGTGGCGCACCTCAATGGGGAAGTGCTGGCCATAGAG
GGATT/- GCATCTGATGAAGGGCGTCCCCCTGAAGCTGCTGTGCCTGAATCCACAGCGCCATGCCTGGCTCTGAACATAAAAAGAGAGATGTGTTTTTGCATCAATAACAATGCCATAAAAACTTCATCCCATGATGAAATACACTTTGTTTCACCTGCTGTTTCCTGGGTTAGATAAATGCACTGAAGCAGCATCTATTCATTTAAGTGCACTTATTAGTATACAAGCATAATTGCCAAATAATACATGAAACAGTGGGCACAGACTGCATTCAGATTGGAATATTACCCAACTTTTTACTGGATATTGCACAAAATACATTGTATTCTGCAAACTAGGCCTGCACCATATATAGTTACAGCATCGATATCGCAATGCGTGCATCTGCAATAGTCACAACGCAAGATATGCAATGTTGCGTCTAATTTATAGTTGACCAGGAGCTACAGAATACATGTGATTTGTAGAGTCACTTTAACCATGATTGAGTAAAGGTTTATAATTTG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations