ZFIN ID: ZDB-ALT-171212-1
Genomic Feature: ihb818
Synonyms:
Affected Genomic Regions: bloc1s2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR2-bloc1s2
Lab Of Origin: Cui Lab
Location: Chr 20: 7584260 - 7584288 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 29 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TTAAAATACATAAATTAAAAAGAACTTTTATACCAATAAATATAATTATATTACAACTACTATTATTTTGAAAAGCTTTTGACCGGAAATGCATGTAATAGTAGCTCATTGTTGCTGACTTCAGTTTTTTTTTCAACTGGCAGAGTTGACACAGCCCCACCTATCTCTGTATAAAACATGTGTATCTTGATATACAGTTAATAAATTATATCAATCAATGGCCCACATTTTGTTTTCAAATTTATTTAATAAATTTATTAGATGCATGCAAGGAAAAAATACACAAAAAAAGTGGTATCAACTAATATGACTATTTAAATTAAAATATTAATATACTTTTCACCTTCTTGACACATCATACATAAATCTGTTTGGTTCTAAAATAGTCCCTTTCGTTTCACTGCACAAGAGAATAAAAATAAAAATACGGAACCGAGGAATCACGTGAAACCGGTCCTGCTCATGTGATGTGAAAATGGCCGCTACGGGGGATGAGGCCG
CGGCGATGGACAGCATCAGTAAAGCACCG/-
GCTCCCCCGACAGAGCTCAACCTCACAGCCGAGCCCGAGAACAGCAGAGAGGCGACCACCAGCGACACGACAGAGAACCAGAAACCCAAAAGACCCAGTAATAACAGTGAGCTGCAATTGTAAACAACACTGTTTGTGTGCTAGTCACTGTGCATGTTAAGTTCTGCAGTGATTCTCTTTACGTTGCTGCTGTCGATAATGTTGTGTTTTTAACTAATGCAACTTGTTTCTGGATATATTTCTGTTATTCTGTTCTTGAAAGACGCATTTCGTGTATTGACTTTAAATATTTGTATATGGCAAGCCGTTTTAACAGTTAATCAATGAAACACAGCCTGCAAGTATTTTCATGCTACAGTTCACTCAAGCTTATTTCCTGCTTTTATCGGGGCCTGCCACAGCGAAATGAACTGCCAATTGTGGTTATGTTTTTTATGCAGTGGATGTAAGCGCCGGGACTTTCGATCTTCTTGCTGTGAAGTGACAGCTCTAGTAACATG
Comment Citation
homozygotes can survive to adulthood, although with poor growth and low  ... Chen et al., 2018
OTHER ihb818 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous bloc1s2ihb818/ihb818 bloc1s2 ♀+/- ♂+/-

CITATIONS  (2)