ZFIN ID: ZDB-ALT-171016-4
Genomic Feature: oz22
Synonyms:
Affected Genomic Regions: pnrc2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-pnrc2
Lab Of Origin: Amacher Lab
Location: Chr 16: 33104450 - 33104466 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 17 bp deleted in Exon 3 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
GGACATTAGGAGGAACATCTGTCTACCAAATGATCATCACCATCTTATTAAGATGCAGATCTAAAAATAGCTGTAAAATATATTACGCAGCTGGGGCGTTCAAGGAGAAGGCAAAAGGCCAAAGTGAAGCCTTTATCATGTATTGGCTTAAGAGAGCAGCAGTGAGAGACCTTGTTAGGCCTGAACCTTCAGGAGGCTCTTTAACTGAAAGGTCATCAACTCACGATGATCGCCCATGGGAAGAGACACCCAGTGGCTTGGGGGCTTGGGCAGCACACTTGGGGATGGGGGCTCACTAAACTTGGCTCCGGCATAGTTCTGACCACACTGAGCTGATAAAAGTTTGTTCAGATGGGACTCCCAATTCTGATCGTACGGTGTGGCAAAACGAACAGAGCCATTCTTCTTGTCTACAGACACGGCCTGCCGCGCCTCAGGAGACCAAGAATAGCTGGTGCCCTTCTCACCTCTGCGAAGGTGATGGGGCACCCCTAAGGCTC
CTGAGGCGGCAGAATGC/-
ATCACTCCATTCTGGTCTCTACTTCTCTGTTTGCCCCTGCTAACCGGCTGGCTCTTCTTGGGTGCTGGGCGATCTGGAATGTTGTATCTCTCACCACCTCCCATTATATTTTGACTGGATGTCACCTAGCAGAAGACAAAGGTGTAGATTTGTTATATTAAATAAAACATGCATTTATAGTATCTTCAAAACAGGCTTAAAATAAATAAGTGCCCCAGTGATGCAGGCTGACATAAACAAAGGGCTACGTGCAAAACGAGCCCGTCCCCGCCCATCCCCCACTCGCTTCCTCTTCTTACCTCTCTGTTGTAAAAAAGTTGAGTGCGTGGTTCTTTTCACTTTTTAATTTTTCCTCGCCAATTGGGCTCCAGGTCCTCGAAGTAGTTGATCTACTTCTCGCTGCACATGTATGTCCAGCAAGATCTGAGGTTTTCATGTGCCAGTGAGCGTTGTTTTGTCGTGGAACCGAGTTGAACATGAATTCACCTCGGCGCACGGTG
Comment Citation
predicted mutant protein determined from sequenced genomic DNA contains the  ... Gallagher et al., 2017
OTHER oz22 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous pnrc2oz22/oz22 (AB) pnrc2 ♀+/- ♂+/-
Complex pnrc2oz22/+; snip1Df(Chr16:fbxl4,coq3,pnrc2,pou3f1,rspo1,gnl2,dnali1,snip1)b644/+ coq3, dnali1, fbxl4, gnl2, pnrc2, pou3f1, rspo1, snip1

CITATIONS  (1)