Genomic Feature

sd51

ID
ZDB-ALT-170913-2
Name
sd51
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Yury Miller Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 22: 15626421 - 15626425 (GRCz11) (1) Details
Nucleotide change
TTATC/CTT
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
3 bp inserted / 5 bp deleted in Exon 4 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GAACCTGAAGATGACCTGTGCTACATAGTTCCTGGTCAACCCCAATCCATCAAAGACTGTAACTTCAATACAGAAACCAAGACTTTTATAGTTATTCATGGATGGACGGTAAGTGCTGCCTTTTTTTTTTTTTTGTCTGCACTGAATGTGCACTGCAGTCCAAGCAATGATGTTTTTTTTTTCTCAGGTCACGGGAATGTTTGAGAGCTGGGTTCCCAAACTGGTAACAGCTCTTTATGAACGAGAGCCCTCAGCCAATGTTATTGTTGTGGACTGGTTGTCCCGTGCGCAACAACATTACCCAACATCAGCCTCCTACACAAAACTAGTTGGCAAAGACGTGGCCAAATTTGTCAACTGGTTACAGGTATGCCAAGCTCTCAGAGTTTTCCAAATTTTGGTTACAATCATAAAGAGAAAATTTGTTGAAGATATAGAGCTTGTTTCATGCCTTAAACTTTATCCTGCATGTCTTGTTTTCTCGTCCAGGCTGAAATTGA
TTATC/CTT CTTGGGAGAAGCTGCATCTGTTGGGTTACAGTCTTGGCGCTCATGTTGCAGGAATCGCTGGCCTTCTCACCAAACATAAAGTTAACAGAATCACAGGTAACTTGATTTAGATCTCTTAAAGCCCTGATATACTTGCAGAAAAGTTTTTTGTTTCCATGTAGCCCCTATGATTTTGCTCAGGATTTAAACTGGTGTAGGAGGCTGATGAACAAAGACGCTAAAGATCGCAACTTATAGCATCTGTTTAAATCCCAATAACATTTCCCTGCCTCTGATCTTGATGGACTAACCAGAAGAAATTAACTAAGGATTATTTCAATAGCTGGGTTTCCATCACCCCGTGTTAATGTCCATTTTGAAGTTTCGCATGAGAAACGAGTGATGGAATTAGCACATTTTGAAATACTTTAATTCGCAAAAAAAATTATACATTTGCTTGAGGTGGTTTAGAACTTGTGCCAAATAAAATTCATGCGAGTAGTAGATGGAAGCTAATTTGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations