Genomic Feature

ouc1

ID
ZDB-ALT-170629-1
Name
ouc1
Synonyms
  • allele1 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Laboratory of Molecular Medicine
Current Source
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 2: 56647763 - 56647766 (GRCz11) (1) Details
Nucleotide change
ATCC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
4 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
AGACACTAAATAGACACGTCAATTTGTTTAATATAAAATTAATAGTAATCTGACCAGTTAACCGTTAATAACCGATTAATGAGCGGCGGTTGTCGGTTCGCAAAATTAACCGAAATGAGCATCCCTAATTAGGACTCACGCATACCACAAGTTGAACACCCCCTATTAACCTCTCTAACACCACTTGCAACAGCAAGCTAGTTTTTTTACCTGCTTACAGATTTCTAGTCATCACGAAGACATTAATTAGCATGTTCACGCGTGTTCGATTAGTGTTGGAGCTAAACAATGCAGGACACCGACCCTCAAGGATCAAGTTTGCCCACCCCTGCTCTATGGATAGAGACTTATTTTACATCTTGTTTAAATGCCCCTTTTTACAAATCGCTTGCAGTACATTTAAAAACAATAATAATAATAAAAAAAGTCTTCAATTGTATATTTAATGTAGTGCAGTGTAATACGCACCTGCTTTCCGAACTGGTTGCAGGGGAAGCCCA
ATCC/- GCGTAAACCCTTCTCAGCGTACGTGACGTGCATTGCCGCAAGCTGAGTGTAGTTTACTGGAGTTTTACCTCATTTAGAGGCTACGTTTGTGATGATACACACATAACCCCTGAAAAATAACACACAAACACACTTCAGACACCACGGCACAGTTTCACACACTAACATTAACCAGACGCACAATCAACAAATGTGAAGTGACTGATGGAGGCGAGGATCAGGAACAAGAGAAAGTGTGTAAATTTGCTTTTATTAGTGTAAAGTTAGATTAAACAGCGCACAGTACTTGTCATAAGTTTGACGTTTTAATTAAAACTACAGGTATTGTGAGACAAAACTGCATTTAGGTGCACAAAAATACTGTAAAAACACGCATTGCATTATTACTAAAGATTCCAGTGTCACGGGATCCTTCAAAACACAGTAGAATACATTTTAAAAGGTTTTCACAGAGAAAAATAATGCTTTATAGTAACCATTTTACTTTGGGCTGCACGATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations