Genomic Feature

ch200

ID
ZDB-ALT-170412-1
Name
ch200
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Chuan He Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 17: 27414147 - 27414154 (GRCz11) (1) Details
Nucleotide change
ATTCCTGA/-
Variant Notes
8 bp deletion upstream of the YTH RNA-binding domain
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
TCTTCAACACTTGACGTGCCTTGTCTAGAGGAACCTCCTGTGTGTCGCGAGAGTTGGTTACCGGCTTATTCTCATTGTTCTCCAAGCGAATGTGCCTTAGTTGGCTGTTGGGAACGTCCTTGACAAAGATCCAGCGCACATCGAAACGACCCTTCCACTTGTCCTGCGACCACACGCCTGCACAAGTGTTGTAGTCCACAGGCGAGCGCATCTCCGCCACGCCACAGAAGTGCCCACTGCCATTCACACTGAAGAGCAGGTACAGTGGCCCTTTGTTGGCTAGCGAACGGTATGCAGCGTCCAGACGCTTATTGCCATGTTCTGTGCTGCACCAGATATTGTACTTAATGGACCGGTGGATATCGTCCTCAGAGTAACTCTTGATGATGAAGACACGACCATGTTTAGGGTTCCAGTCGAAGTCCTTGGGATTGTAGTTGTTTACCATGCGCAGTTTTTCTAGAACTGGGTGGGGTTCTGCTGGCACAGTAATGCCACCC
ATTCCTGA/- ATTGGGAGGGGATTGGCCAGGTCCACCTGCTGCATCCCCAAAGCCGTTGGCACGGTTACGCGGGGGCACCCAGCGGGTTGGCTGGGAGGGTTGGGAAGCTGGTGGGCCCTGGGAGAGTTGAGGTGGAACAGCACCGGGCTGGCCACCTGGAGGAAGAGGGTGCTGGACAAGCTGTCCAGTAGGAGGAACTAGCTGTCCATTGCTGAGGGGCAACTGAGGCACCCCACCAGCAGTAGCACCTGGTTGAGGAGACGACTGATTGGGTGGCTGTCCATTAGTGGGCAGGGAAGTCTGCTGTGGGGCTGCTGGTTTAGGCATATTCCCCTTGTTGTCCCATGTCCCAATATCCATGTTATGTTTTATTGGAGGTGGTGGCAGATTTGTCCCACCAAGTCCCCCCTTAGTTTTCAATTTAGGCTGTGGTTTGGCTGGCTTGCTGGCAATGTCCGCCCAAGAAGCAGTTTTCGCAGGAGCCATGGAGGCAGGAGGCATGGTTGGAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations