Genomic Feature

hu11443

ID
ZDB-ALT-161122-15
Name
hu11443
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Bakkers Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 18: 39074312 - 39074319 (GRCz11) (1) Details
Nucleotide change
AACTGGAG/GGAGGAGAGAGGAGA
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
15 bp inserted / 8 bp deleted (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
CCTCAGTTATTTTTTCCTTATTGAAAGGGGTTATTTTGTCTTGTTATTGTATTGTATTATTGCACATTATAAAATTGTTGTTATCCTCGTCCGATATTGTCGAAGATAAAGGTCCCAGAATGCAATTCGATAGCGTCAAAAACGCAAAACACCCCATGATGCAATATCATTACGATTTTTTAAACAAAAATAAAAAAAAAGTATATATGATATCAGATGTATAAGTCACAATCAGATGTAAAAGTGATTTTGGCTTCAGTCAGGGCTCCAAAAATAAATGTGATGCTGATGGTGGTGATGTGTCACGTGACTCGGGCGCTCACGTCAGAGCATCATCAGCTGTGCAGACTGTGCAGTATCAGTCTCGGCTTATGATAAAAAATCATATTTACTGACCAATTCGCCATCCGTTTGTGCTTTATTAAAGATGGCCTGTCAGGGACTGGCGAAGGGCGAAACTGTCCAAAGCCTGAAAGCGGAGTCGGAGTCTTTAAAAGCCA
AACTGGAG/GGAGGAGAGAGGAGA GAGGAGAGAGCCAAACTACACGACGTCGAGCGTGAGTAAAACCCTCAGCGGCTGTGTGTCAAAACCCAGCAAGCTGCCTAGATAGACTGCATTCGTGGACATTACTGCAAGACGCCAAAATTGCTTGTATTCGATTTGAATTGCAGCAAAAACGAGATAAATGTAGGAGAAATACTCATTGGTGTCCACGTAAACTACCGCTATCAAAACCTGTCTCATTATGCATGAATTCAAGGAGACGTTTAAATGTTTAATGTAATGTTTTGAGGCCTATGATGTTATGGTCAAGAATTACATTTAATTTTAATCCTGTTATATTGTTAAGCCTATGATTTAGGCGTAATATAACTAGATTTTTTTATTAAAAGTTAGATTTTGCCATGAAAAAATGGAATGGATGGTAAATTACTTGGAGATTTTTCTCATTTATGTTAGGTTTAGATTATGTGTTAGGTTTATTATTATTGTTTTATTGTTGTATAATTTTTTAATATAAATAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations