header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-20331
Genomic Feature: sa28193
Synonyms:
Affected Genomic Regions: cdh23 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 43180344 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AACTCTATATTCAGTCTAAATTGTGATCTTCCAAATCTTTACCCGCAGGT
A/T
AAATTGTGGCCAATCGGACGGTGGATTTTGAGCAAGTGCAGTGGTTGAAC
(1)
OTHER sa28193 PAGES
ZMP:sa28193 (1)
GENOTYPESNo data available

CITATIONS  (1)