Genomic Feature

ck018

ID
ZDB-ALT-160817-4
Name
ck018
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Cheol-Hee Kim Lab
Current Source
Other Pages
Notes
No data available
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 11: 3379790 - 3379800 (GRCz11) (1) Details
Nucleotide change
AGGTCACTCCC/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
11 bp deleted in Exon 4 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TAGAAGGAGGTGAGCTTCCCTCCCTCCAGGACATCTACACCAGGCGGTGCATGAGGAAAGCCAAGAGAATTATCAGTGACTCCAATCCATACTTGAAACAACACTGCCTACAACTATGTGGACACCTTTTCATTGTAAATATCACTGACAATCCTACATTGTCCTTTTTTTGCATGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGAGTATGCTGTTGTATTTTGCACTGTCTGTATTTGCACTGTCATTGTATTAGCAACCTCTGTATTTAGTACTGTCTGGAGCCAGCACCTAAGCTTTTCACTCATCATAGCACACATGCTGCTGATGATGTGACAATAAAAGTGATTTGATCATTTTGACTTTATCTATATAGTGTAATACATTTTTTATAAGTAAAGTCAGTATCTAAAAAAGCCAATTTACTTCAAAAAATCACTGCATCACTTAATTGAACATTAACTTCAAGTACCTTTTTCTTGTCGCTGGACATG
AGGTCACTCCC/- AGGGCATCTGATTGGCTCAATAACTGGCTGGCCTTTGACCCGAGTGGTAGATTTTGCGAGGCTACTTTCAACCAGTTCATCATCAAACTTCTTTCTCTTTATTGATCTAAAAAAAGCAACAGTGAGACCCCTCAGTTTTACAATGAAGTGTAGAGCACACAGTGAAGCAGATGATGGATCTTCACCTAGAGGAGCTCCGGCGTTTGGGGATCAGCCCTGCTCCGCTGAAGGCCTGAGCAGCACTTCTCTTCACAGCGGCCGACTGCTCGTCCTCTGACCTGCTCTGTGAAACCATCGGCCCGACTGACGATCCTGCACCCACAGCAGACGGAACAACCGCCTTTACATCTGCAACACAATAAGATATAGATCATTTATGTATTTATTAGCAGGTTTATTTAACAAAGACAATGCAGAATAACATTGCAGTTTCAGCAGTCAAGCCAAAAGATATTATGCGACTTTACACTCAGGTTAGGCTTTTTATACACTAAAACAGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations