ZFIN ID: ZDB-ALT-160728-2
Genomic Feature: bns59
Synonyms:
Affected Genomic Regions: npas4l (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-npas4l
Lab Of Origin: Stainier Lab
Location: Chr 13: 52011843 - 52011850 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation: at position 564 (1)
FLANKING SEQUENCE (GENOMIC)
TGATGCTCACAGCGCACACACACTCTTCTGCACGCCACCCTACAGCCCCACTTCCTCTCAGTGCTCTGACTTCCTGTCTGAAGGTTATGGCTCTCTGGAGGCGCTGGTGGATTCTGCCTTCTGCTCTCCGCCGTACCCGCCGCTGTTCCCCAACCCATGCTGCACCCCCACTGTCTGCCCACCGGACACTGCCCTGGACCCCGCTCGGCTCTGCCCGCCAGATTCTGCCCTGGACCCCGCTCGGCTCTGCCCGCCAGATTCTGCCCTGGTCCCCGCTGCGCTCTGTCCGCCGGACGCTGCCCTGGACCCCACTCAGCTCTGCCTGCCGGACGGTGCCTTGGTCCCTGCTGCGTTCTGCCCGCCGAACGGTGCCCTGGTCCCTGCCCGGCTCTGCCCGTCAGATGCTGCCCTGGTCCCCGCTGCACTCTGTCGGCCGGACGCTGCCCTGGTGCCTGTGTGTCGGCCACTGCAGGTGTGTGAGTGCCCTCTGGATGGCGCTG
TGCCGCTG/-
GAGGACCTCAGCATGTTCCCGCTGCCGCAGGGCGGAGGCTCTCGTCTGATGCCGCCTGAAGCATCACCCACTACCGACACACACTTCTCGTATGATGCAGCACAGCAGGCGGGGATCGGCACGTTGGCAATGCAGATACACACACTCATCTGCAGCTTCGATGCGTACAGCGCCGCGCAACACACACACTCTCACCACACCTCCTGCTGGGCACCAGAGCCACTGCTGGACGAGGGCATCATCGACAGCATCCTCAGAGAGCTGGACAGCACACACACTAATGCACACACACTGACACACACACACACTGATGCACACACACTGACACACACACACACACACACACACACACTGATGCACACACACTGACACACACACACTGACACACACACACACTGATGCACACACACTGACACACACACACTGACACACACACACACTGATGCATACACACTGACACACACACACACACACACACACACTGATGCATACACACTGAC
NOTES
Comment Citation
Protein truncates at position 564 after 19 missense amino acids. Reischauer et al., 2016
OTHER bns59 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous npas4lbns59/bns59 npas4l ♀+/- ♂+/-
Complex npas4ls5/+; npas4lbns59/+ npas4l
npas4lbns59/+; s843Tg npas4l
npas4lbns59/bns59; s843Tg npas4l
npas4ls5/+; npas4lbns59/+; s843Tg npas4l

CITATIONS  (1)